Transcript: Mouse NM_019911.2

Mus musculus tryptophan 2,3-dioxygenase (Tdo2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tdo2 (56720)
Length:
1646
CDS:
36..1256

Additional Resources:

NCBI RefSeq record:
NM_019911.2
NBCI Gene record:
Tdo2 (56720)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019911.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076335 CCAAAGATGAATCCGATCATT pLKO.1 1170 CDS 100% 5.625 7.875 N Tdo2 n/a
2 TRCN0000076337 GCGCAAGAACTTCAGAGTGAA pLKO.1 195 CDS 100% 4.950 3.960 N Tdo2 n/a
3 TRCN0000076333 GTGAGCGATTAGGAGGATTAA pLKO.1 1416 3UTR 100% 13.200 9.240 N Tdo2 n/a
4 TRCN0000424054 ATCATAACTCATCAAGCTTAT pLKO_005 252 CDS 100% 10.800 7.560 N TDO2 n/a
5 TRCN0000076334 GCCTGGAAGAAGAATTTCTAA pLKO.1 733 CDS 100% 5.625 3.938 N Tdo2 n/a
6 TRCN0000076336 GCTGGAAAGAACACCTGGTTT pLKO.1 659 CDS 100% 4.950 3.465 N Tdo2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019911.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01657 pDONR223 100% 83.2% 88.6% None (many diffs) n/a
2 ccsbBroad304_01657 pLX_304 0% 83.2% 88.6% V5 (many diffs) n/a
3 TRCN0000473643 TGTCCCACAGGAGCATGGAAGCCC pLX_317 45.4% 83.2% 88.6% V5 (many diffs) n/a
Download CSV