Transcript: Mouse NM_020028.3

Mus musculus lysophosphatidic acid receptor 2 (Lpar2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Lpar2 (53978)
Length:
5701
CDS:
157..1203

Additional Resources:

NCBI RefSeq record:
NM_020028.3
NBCI Gene record:
Lpar2 (53978)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020028.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234207 ACGCTTCCACCAGCCCATATA pLKO_005 330 CDS 100% 13.200 18.480 N Lpar2 n/a
2 TRCN0000367688 AGGCCAACTCACTGGTCAATG pLKO_005 1001 CDS 100% 10.800 8.640 N LPAR2 n/a
3 TRCN0000218085 AGATGCTATCCAGGGATTTAT pLKO_005 3479 3UTR 100% 15.000 10.500 N Lpar2 n/a
4 TRCN0000234210 TGATGGACTCCACCCTTTAAA pLKO_005 1184 CDS 100% 15.000 10.500 N Lpar2 n/a
5 TRCN0000234209 TGGTCAATGCAGTGGTATATT pLKO_005 1013 CDS 100% 15.000 10.500 N Lpar2 n/a
6 TRCN0000234208 TAGCTGTCTACACACGAATTT pLKO_005 761 CDS 100% 13.200 9.240 N Lpar2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020028.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02097 pDONR223 100% 85.8% 91.4% None (many diffs) n/a
2 ccsbBroad304_02097 pLX_304 0% 85.8% 91.4% V5 (many diffs) n/a
3 TRCN0000473080 ACCTCATCTAAACCTAAACACCCG pLX_317 23.6% 85.8% 91.4% V5 (many diffs) n/a
4 TRCN0000489888 CTCGCTGCGCCGGTAGTAAGGGCT pLX_317 36.8% 85.7% 91.4% V5 (many diffs) n/a
5 TRCN0000489806 TCTAACGTCTTTTTCTTTCCTTAT pLX_317 39.5% 85.7% 91.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV