Transcript: Human NM_020123.4

Homo sapiens transmembrane 9 superfamily member 3 (TM9SF3), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
TM9SF3 (56889)
Length:
6100
CDS:
178..1947

Additional Resources:

NCBI RefSeq record:
NM_020123.4
NBCI Gene record:
TM9SF3 (56889)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020123.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059372 CACGTCTTTCTGGGCATATAA pLKO.1 1584 CDS 100% 15.000 10.500 N TM9SF3 n/a
2 TRCN0000315710 CACGTCTTTCTGGGCATATAA pLKO_005 1584 CDS 100% 15.000 10.500 N TM9SF3 n/a
3 TRCN0000059368 CCTACCATAATCGTCAAGAAA pLKO.1 326 CDS 100% 5.625 3.938 N TM9SF3 n/a
4 TRCN0000059371 CGATTGGTTACATGGGAACAA pLKO.1 1883 CDS 100% 4.950 3.465 N TM9SF3 n/a
5 TRCN0000315712 CGATTGGTTACATGGGAACAA pLKO_005 1883 CDS 100% 4.950 3.465 N TM9SF3 n/a
6 TRCN0000059370 CCAGCCACTTACTGTGAAATT pLKO.1 487 CDS 100% 13.200 7.920 N TM9SF3 n/a
7 TRCN0000349129 CCAGCCACTTACTGTGAAATT pLKO_005 487 CDS 100% 13.200 7.920 N TM9SF3 n/a
8 TRCN0000059369 CGGTACAGTAAAGAGGAAGAA pLKO.1 937 CDS 100% 4.950 2.970 N TM9SF3 n/a
9 TRCN0000315646 CGGTACAGTAAAGAGGAAGAA pLKO_005 937 CDS 100% 4.950 2.970 N TM9SF3 n/a
10 TRCN0000124993 TCAGTCATTACCATGAAACTT pLKO.1 395 CDS 100% 5.625 3.938 N Tm9sf3 n/a
11 TRCN0000311894 TCAGTCATTACCATGAAACTT pLKO_005 395 CDS 100% 5.625 3.938 N Tm9sf3 n/a
12 TRCN0000124989 GCAAGAAGAGATTTGGGCTTA pLKO.1 2025 3UTR 100% 4.050 2.835 N Tm9sf3 n/a
13 TRCN0000311896 GCAAGAAGAGATTTGGGCTTA pLKO_005 2025 3UTR 100% 4.050 2.835 N Tm9sf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020123.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14220 pDONR223 100% 77.5% 77.2% None (many diffs) n/a
2 ccsbBroad304_14220 pLX_304 0% 77.5% 77.2% V5 (many diffs) n/a
3 TRCN0000479084 TAAATGGTGCTGGCTGTGTTTTAT pLX_317 29.4% 77.5% 77.2% V5 (many diffs) n/a
Download CSV