Transcript: Human NM_020175.3

Homo sapiens dihydrouridine synthase 3 like (DUS3L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DUS3L (56931)
Length:
2038
CDS:
23..1975

Additional Resources:

NCBI RefSeq record:
NM_020175.3
NBCI Gene record:
DUS3L (56931)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020175.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064846 CGGCTGGACATCCGTGGCAAA pLKO.1 920 CDS 100% 0.000 0.000 N DUS3L n/a
2 TRCN0000315797 CGGCTGGACATCCGTGGCAAA pLKO_005 920 CDS 100% 0.000 0.000 N DUS3L n/a
3 TRCN0000064847 CTTGTCATTTGAGGATGCCAA pLKO.1 1522 CDS 100% 2.640 2.112 N DUS3L n/a
4 TRCN0000315796 CTTGTCATTTGAGGATGCCAA pLKO_005 1522 CDS 100% 2.640 2.112 N DUS3L n/a
5 TRCN0000064844 CAAGGAGCAGTTTCACCAATT pLKO.1 133 CDS 100% 10.800 7.560 N DUS3L n/a
6 TRCN0000315798 CAAGGAGCAGTTTCACCAATT pLKO_005 133 CDS 100% 10.800 7.560 N DUS3L n/a
7 TRCN0000064843 GCTAAGTGTTTCTTCGGTGAT pLKO.1 419 CDS 100% 4.050 2.835 N DUS3L n/a
8 TRCN0000349131 GCTAAGTGTTTCTTCGGTGAT pLKO_005 419 CDS 100% 4.050 2.835 N DUS3L n/a
9 TRCN0000064845 CCTGCGGGACTTCACCAACTA pLKO.1 1669 CDS 100% 1.650 1.155 N DUS3L n/a
10 TRCN0000315808 CCTGCGGGACTTCACCAACTA pLKO_005 1669 CDS 100% 1.650 1.155 N DUS3L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020175.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15929 pDONR223 0% 62.7% 62.7% None 174_899del n/a
2 ccsbBroad304_15929 pLX_304 0% 62.7% 62.7% V5 174_899del n/a
3 TRCN0000481079 GAACTCTTTGTCAGTCCGACACAG pLX_317 36.4% 62.7% 62.7% V5 174_899del n/a
Download CSV