Transcript: Human NM_020227.3

Homo sapiens PR/SET domain 9 (PRDM9), transcript variant B, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
PRDM9 (56979)
Length:
3697
CDS:
189..2873

Additional Resources:

NCBI RefSeq record:
NM_020227.3
NBCI Gene record:
PRDM9 (56979)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020227.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358533 TTAAGAGTGGAACAGCGTAAA pLKO_005 510 CDS 100% 10.800 15.120 N PRDM9 n/a
2 TRCN0000016804 GCAGCAATATCCAGATCCACA pLKO.1 1502 CDS 100% 2.640 3.696 N PRDM9 n/a
3 TRCN0000016806 GACAAGGTTTCAGTGTTAAAT pLKO.1 1777 CDS 100% 15.000 10.500 N PRDM9 n/a
4 TRCN0000367911 CCAGATCCACACAGCCGTAAT pLKO_005 1512 CDS 100% 10.800 7.560 N PRDM9 n/a
5 TRCN0000358488 GGCTTTAGAGATAAGTCAAAC pLKO_005 2538 CDS 100% 10.800 7.560 N PRDM9 n/a
6 TRCN0000016805 CGATAGGTCAAGCCTCTGCTA pLKO.1 2798 CDS 100% 2.640 1.848 N PRDM9 n/a
7 TRCN0000016807 GATAAGTCAAACCTCCTCAGT pLKO.1 2547 CDS 100% 2.640 1.848 N PRDM9 n/a
8 TRCN0000358532 TGTCAAGAACAGCAAATTTAC pLKO_005 586 CDS 100% 13.200 7.920 N PRDM9 n/a
9 TRCN0000015176 GCTATGAGTATGTGGATGGAA pLKO.1 1090 CDS 100% 3.000 1.500 Y PRDM7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020227.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02621 pDONR223 100% 18.5% 13.8% None (many diffs) n/a
2 ccsbBroad304_02621 pLX_304 0% 18.5% 13.8% V5 (many diffs) n/a
3 TRCN0000491630 GCTATCAAATGTTTGTGAAGCGCC pLX_317 64.9% 18.5% 13.8% V5 (many diffs) n/a
Download CSV