Transcript: Mouse NM_020267.2

Mus musculus tripartite motif-containing 44 (Trim44), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Trim44 (80985)
Length:
5612
CDS:
217..1254

Additional Resources:

NCBI RefSeq record:
NM_020267.2
NBCI Gene record:
Trim44 (80985)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020267.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037321 CCAATCTCACATGGATAGGTT pLKO.1 1116 CDS 100% 3.000 4.200 N Trim44 n/a
2 TRCN0000037323 GCAATGATAGAGTTGGTGGAA pLKO.1 916 CDS 100% 2.640 2.112 N Trim44 n/a
3 TRCN0000317371 GCAATGATAGAGTTGGTGGAA pLKO_005 916 CDS 100% 2.640 2.112 N Trim44 n/a
4 TRCN0000037320 CGAGACCAGATGAAGATATTT pLKO.1 973 CDS 100% 15.000 10.500 N Trim44 n/a
5 TRCN0000317439 CGAGACCAGATGAAGATATTT pLKO_005 973 CDS 100% 15.000 10.500 N Trim44 n/a
6 TRCN0000313856 TGTTAGGGCAACTGGGTTAAA pLKO_005 1747 3UTR 100% 13.200 9.240 N Trim44 n/a
7 TRCN0000037319 GCACCTATTGTCAGGAAGATA pLKO.1 779 CDS 100% 5.625 3.938 N Trim44 n/a
8 TRCN0000317438 GCACCTATTGTCAGGAAGATA pLKO_005 779 CDS 100% 5.625 3.938 N Trim44 n/a
9 TRCN0000033850 CCAGTGAAGAAGAGGACACAT pLKO.1 1232 CDS 100% 4.950 3.465 N TRIM44 n/a
10 TRCN0000289975 CCAGTGAAGAAGAGGACACAT pLKO_005 1232 CDS 100% 4.950 3.465 N TRIM44 n/a
11 TRCN0000037322 GTAGACAGTGAGTCGGAAGAA pLKO.1 529 CDS 100% 4.950 2.970 N Trim44 n/a
12 TRCN0000317370 GTAGACAGTGAGTCGGAAGAA pLKO_005 529 CDS 100% 4.950 2.970 N Trim44 n/a
13 TRCN0000029459 CAGGTGGAGATTGTCACTGAT pLKO.1 2077 3UTR 100% 4.950 3.465 N CAPG n/a
14 TRCN0000343019 CAGGTGGAGATTGTCACTGAT pLKO_005 2077 3UTR 100% 4.950 3.465 N CAPG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020267.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08408 pDONR223 100% 88.1% 91.6% None (many diffs) n/a
2 ccsbBroad304_08408 pLX_304 0% 88.1% 91.6% V5 (many diffs) n/a
3 TRCN0000469145 GTTTAAAAACTTCCCGTATGGTTC pLX_317 36.5% 88.1% 91.6% V5 (many diffs) n/a
Download CSV