Transcript: Human NM_020348.3

Homo sapiens cyclin and CBS domain divalent metal cation transport mediator 1 (CNNM1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CNNM1 (26507)
Length:
5702
CDS:
33..2888

Additional Resources:

NCBI RefSeq record:
NM_020348.3
NBCI Gene record:
CNNM1 (26507)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020348.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423938 ACGGTTCTGGAGGAGTTTAAG pLKO_005 1581 CDS 100% 13.200 18.480 N CNNM1 n/a
2 TRCN0000437421 CCATTGTCCAGCGGGTGAATA pLKO_005 1621 CDS 100% 13.200 18.480 N CNNM1 n/a
3 TRCN0000045224 CGGCATGACTTCTCCTTGTTT pLKO.1 1794 CDS 100% 5.625 7.875 N CNNM1 n/a
4 TRCN0000077842 CTCTACACTGACAATCGGAAA pLKO.1 1743 CDS 100% 4.050 5.670 N Cnnm1 n/a
5 TRCN0000425248 CCACTGCTTGCTCAGATAATG pLKO_005 2146 CDS 100% 13.200 9.240 N CNNM1 n/a
6 TRCN0000045225 CCAGGAAGAAATGACTGACTT pLKO.1 2627 CDS 100% 4.950 3.465 N CNNM1 n/a
7 TRCN0000045223 CGGCACAACATTGTGGACATT pLKO.1 1446 CDS 100% 4.950 3.465 N CNNM1 n/a
8 TRCN0000045226 CTCCAATTTAACACCTCTGAT pLKO.1 2861 CDS 100% 4.950 3.465 N CNNM1 n/a
9 TRCN0000045227 CCTGAAACATCCCAACGTGAT pLKO.1 1943 CDS 100% 4.050 2.835 N CNNM1 n/a
10 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 4234 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020348.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11827 pDONR223 100% 61.5% 61.6% None 1_1095del;1284T>G n/a
2 ccsbBroad304_11827 pLX_304 0% 61.5% 61.6% V5 1_1095del;1284T>G n/a
3 ccsbBroadEn_15035 pDONR223 92.5% 61.3% 55% None (many diffs) n/a
4 ccsbBroad304_15035 pLX_304 0% 61.3% 55% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000476036 CTGATCTAGGTATCATCTTGCTCA pLX_317 19.4% 56.3% 56.2% V5 1_1095del;1284T>G;2525_2674del n/a
Download CSV