Transcript: Human NM_020351.4

Homo sapiens collagen type VIII alpha 1 chain (COL8A1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
COL8A1 (1295)
Length:
5515
CDS:
200..2434

Additional Resources:

NCBI RefSeq record:
NM_020351.4
NBCI Gene record:
COL8A1 (1295)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020351.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442905 GGGAGTGCTGCTTACCATTTC pLKO_005 232 CDS 100% 10.800 15.120 N COL8A1 n/a
2 TRCN0000425716 TACACGTACGACGAGTACAAA pLKO_005 2258 CDS 100% 5.625 7.875 N COL8A1 n/a
3 TRCN0000414863 GAAATACCATTAGCCAGTTTA pLKO_005 527 CDS 100% 13.200 9.240 N COL8A1 n/a
4 TRCN0000116521 GTCATGGGATACCTGGAATTA pLKO.1 615 CDS 100% 13.200 9.240 N COL8A1 n/a
5 TRCN0000116518 GCCTATGAGATGCCTGCATTT pLKO.1 2033 CDS 100% 10.800 7.560 N COL8A1 n/a
6 TRCN0000116520 AGCCTATGAGATGCCTGCATT pLKO.1 2032 CDS 100% 4.950 3.465 N COL8A1 n/a
7 TRCN0000116519 GCTGTATAACGGCAGACAGAA pLKO.1 2113 CDS 100% 4.950 3.465 N COL8A1 n/a
8 TRCN0000116517 GCCACCACAAATTCCACAATA pLKO.1 331 CDS 100% 13.200 7.920 N COL8A1 n/a
9 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 3719 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
10 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 3825 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020351.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00342 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00342 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470876 GAAAACCACCGTTAAGGACGTCAC pLX_317 18% 100% 100% V5 n/a
Download CSV