Transcript: Mouse NM_020606.5

Mus musculus parvin, alpha (Parva), mRNA.

Source:
NCBI, updated 2017-05-07
Taxon:
Mus musculus (mouse)
Gene:
Parva (57342)
Length:
4450
CDS:
260..1378

Additional Resources:

NCBI RefSeq record:
NM_020606.5
NBCI Gene record:
Parva (57342)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020606.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112666 CGACTGGATCAATGACGTATT pLKO.1 565 CDS 100% 10.800 15.120 N Parva n/a
2 TRCN0000335673 CGACTGGATCAATGACGTATT pLKO_005 565 CDS 100% 10.800 15.120 N Parva n/a
3 TRCN0000348578 GCGAAGGTTTGCTATCCATTA pLKO_005 1821 3UTR 100% 10.800 15.120 N Parva n/a
4 TRCN0000112668 CTCGACAAATCCAAGAGGAAA pLKO.1 939 CDS 100% 4.950 6.930 N Parva n/a
5 TRCN0000335752 CTCGACAAATCCAAGAGGAAA pLKO_005 939 CDS 100% 4.950 6.930 N Parva n/a
6 TRCN0000375388 GTCCACGCTGAGAGTGCTATA pLKO_005 1324 CDS 100% 10.800 7.560 N Parva n/a
7 TRCN0000122983 CAAGTGGTTGTGGTCCAGAAA pLKO.1 899 CDS 100% 4.950 3.465 N PARVA n/a
8 TRCN0000112667 GATGCCTTTGACACGCTGTTT pLKO.1 1001 CDS 100% 4.950 3.465 N Parva n/a
9 TRCN0000112665 GCGTGGAGAATGTCAGTCATT pLKO.1 2484 3UTR 100% 4.950 3.465 N Parva n/a
10 TRCN0000112669 GTTCGTGAACAAGCATCTGAA pLKO.1 1069 CDS 100% 4.950 3.465 N Parva n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020606.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03645 pDONR223 100% 90.2% 98.3% None (many diffs) n/a
2 ccsbBroad304_03645 pLX_304 0% 90.2% 98.3% V5 (many diffs) n/a
3 TRCN0000468240 TTCTATATAAAATGGAGTCCTTGG pLX_317 38.6% 90.2% 98.3% V5 (many diffs) n/a
4 ccsbBroadEn_08576 pDONR223 100% 90.1% 97.8% None (many diffs) n/a
5 ccsbBroad304_08576 pLX_304 0% 90.1% 97.8% V5 (many diffs) n/a
6 TRCN0000468355 AGCTCAACAGCGTTGGACCACGAA pLX_317 35.3% 90.1% 97.8% V5 (many diffs) n/a
Download CSV