Transcript: Human NM_020655.4

Homo sapiens junctophilin 3 (JPH3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
JPH3 (57338)
Length:
4382
CDS:
640..2886

Additional Resources:

NCBI RefSeq record:
NM_020655.4
NBCI Gene record:
JPH3 (57338)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020655.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437294 CGTCGACACGAGCTTAGAAAG pLKO_005 3300 3UTR 100% 10.800 15.120 N JPH3 n/a
2 TRCN0000083074 CGCCATTCTGTTTATTAACTT pLKO.1 2856 CDS 100% 5.625 7.875 N JPH3 n/a
3 TRCN0000416523 ATGAGATGTCGCGGTAGCAAA pLKO_005 2886 CDS 100% 4.950 6.930 N JPH3 n/a
4 TRCN0000083076 GCTGCGCAAGTCGGAGTCCAA pLKO.1 1311 CDS 100% 0.000 0.000 N JPH3 n/a
5 TRCN0000083075 AGTCGCCATTCTGTTTATTAA pLKO.1 2853 CDS 100% 15.000 10.500 N JPH3 n/a
6 TRCN0000083077 GAGTCGCCATTCTGTTTATTA pLKO.1 2852 CDS 100% 15.000 10.500 N JPH3 n/a
7 TRCN0000083073 CCAAGTCCTCTCACAGAAGAA pLKO.1 2996 3UTR 100% 4.950 3.465 N JPH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020655.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08721 pDONR223 100% 99.8% 99.5% None 1127T>C;1414C>A;1934C>T n/a
2 ccsbBroad304_08721 pLX_304 0% 99.8% 99.5% V5 1127T>C;1414C>A;1934C>T n/a
3 TRCN0000468442 TGATGCCCGGGAGCAGTTAATGAT pLX_317 17.3% 99.8% 99.5% V5 1127T>C;1414C>A;1934C>T n/a
Download CSV