Transcript: Human NM_020751.3

Homo sapiens component of oligomeric golgi complex 6 (COG6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
COG6 (57511)
Length:
3574
CDS:
66..2039

Additional Resources:

NCBI RefSeq record:
NM_020751.3
NBCI Gene record:
COG6 (57511)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020751.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140782 GTCTGCGGACTCGAAGAAATT pLKO.1 268 CDS 100% 13.200 18.480 N COG6 n/a
2 TRCN0000144272 CGTGGAGATATTGAACGTAAA pLKO.1 291 CDS 100% 10.800 15.120 N COG6 n/a
3 TRCN0000319255 CGTGGAGATATTGAACGTAAA pLKO_005 291 CDS 100% 10.800 15.120 N COG6 n/a
4 TRCN0000143878 CCTAGATTCTGTGACACTGAA pLKO.1 1781 CDS 100% 4.950 6.930 N COG6 n/a
5 TRCN0000319187 CCTAGATTCTGTGACACTGAA pLKO_005 1781 CDS 100% 4.950 6.930 N COG6 n/a
6 TRCN0000145059 CACCATACAATCAGTGGTATT pLKO.1 1218 CDS 100% 10.800 7.560 N COG6 n/a
7 TRCN0000319185 CACCATACAATCAGTGGTATT pLKO_005 1218 CDS 100% 10.800 7.560 N COG6 n/a
8 TRCN0000122418 GCAGTGAATCTCCTTTCTGTT pLKO.1 2594 3UTR 100% 4.950 3.465 N COG6 n/a
9 TRCN0000143469 GCATCTCACGATTCTTCAGTT pLKO.1 1425 CDS 100% 4.950 3.465 N COG6 n/a
10 TRCN0000319256 GCATCTCACGATTCTTCAGTT pLKO_005 1425 CDS 100% 4.950 3.465 N COG6 n/a
11 TRCN0000139234 CCCAACCTAGATTCTGTGACA pLKO.1 1776 CDS 100% 2.640 1.848 N COG6 n/a
12 TRCN0000121989 GCAGGTTTAGAAATTATGGAA pLKO.1 684 CDS 100% 3.000 1.800 N COG6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020751.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08739 pDONR223 100% 99.9% 100% None 738A>G n/a
2 ccsbBroad304_08739 pLX_304 0% 99.9% 100% V5 738A>G n/a
3 TRCN0000479296 TTCCCGGCGCGGAGGACTATCCTG pLX_317 22.6% 99.9% 100% V5 738A>G n/a
Download CSV