Transcript: Human NM_020830.5

Homo sapiens WD repeat and FYVE domain containing 1 (WDFY1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
WDFY1 (57590)
Length:
4607
CDS:
52..1284

Additional Resources:

NCBI RefSeq record:
NM_020830.5
NBCI Gene record:
WDFY1 (57590)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020830.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135369 GTATGCTTTCGTTGGTGATTA pLKO.1 555 CDS 100% 13.200 18.480 N WDFY1 n/a
2 TRCN0000275841 ATGACAGCAGACGGATATTTG pLKO_005 284 CDS 100% 13.200 9.240 N WDFY1 n/a
3 TRCN0000282039 TGGGCTTCGTGTCTGCAATAT pLKO_005 520 CDS 100% 13.200 9.240 N WDFY1 n/a
4 TRCN0000275842 AGCAGCAAGCGCTCAAGTTAC pLKO_005 1027 CDS 100% 10.800 7.560 N WDFY1 n/a
5 TRCN0000136568 CAGTGTGGAACATGGATGTTA pLKO.1 851 CDS 100% 5.625 3.938 N WDFY1 n/a
6 TRCN0000135553 GACTCCATCAAAGATGAAGAT pLKO.1 1096 CDS 100% 4.950 3.465 N WDFY1 n/a
7 TRCN0000136366 CATTGTAAAGATCTGGGACAT pLKO.1 1215 CDS 100% 4.050 2.835 N WDFY1 n/a
8 TRCN0000103689 CGGATATTTGTGGGCCAGGAT pLKO.1 295 CDS 100% 2.640 1.848 N Wdfy1 n/a
9 TRCN0000324426 CGGATATTTGTGGGCCAGGAT pLKO_005 295 CDS 100% 2.640 1.848 N Wdfy1 n/a
10 TRCN0000136093 GCTGTAATGGAATTTCACGTT pLKO.1 322 CDS 100% 2.640 1.848 N WDFY1 n/a
11 TRCN0000275843 GCTGTAATGGAATTTCACGTT pLKO_005 322 CDS 100% 2.640 1.848 N WDFY1 n/a
12 TRCN0000137552 CGATTATCTTCAGCTTGGCCA pLKO.1 407 CDS 100% 0.660 0.462 N WDFY1 n/a
13 TRCN0000275845 CGATTATCTTCAGCTTGGCCA pLKO_005 407 CDS 100% 0.660 0.462 N WDFY1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020830.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03833 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03833 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466652 AGTTAGTTTTTCAGTAACCATGAG pLX_317 32.4% 100% 100% V5 n/a
Download CSV