Transcript: Human NM_020856.4

Homo sapiens teashirt zinc finger homeobox 3 (TSHZ3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
TSHZ3 (57616)
Length:
5065
CDS:
218..3463

Additional Resources:

NCBI RefSeq record:
NM_020856.4
NBCI Gene record:
TSHZ3 (57616)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020856.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015633 CCCTTACATCACGCCAAATAA pLKO.1 1288 CDS 100% 15.000 21.000 N TSHZ3 n/a
2 TRCN0000230689 ACCCTTACATCACGCCAAATA pLKO_005 1287 CDS 100% 13.200 18.480 N TSHZ3 n/a
3 TRCN0000426249 ACCCTTACATCACGCCAAATA pLKO_005 1287 CDS 100% 13.200 18.480 N Tshz3 n/a
4 TRCN0000230690 AGACCACCTCGACCGCTATTT pLKO_005 2539 CDS 100% 13.200 18.480 N TSHZ3 n/a
5 TRCN0000015637 CGACAACCATGAGACCGATAA pLKO.1 940 CDS 100% 10.800 15.120 N TSHZ3 n/a
6 TRCN0000230688 CGACAACCATGAGACCGATAA pLKO_005 940 CDS 100% 10.800 15.120 N TSHZ3 n/a
7 TRCN0000015635 CGTCGTATCATTCATGTCAAA pLKO.1 2704 CDS 100% 4.950 6.930 N TSHZ3 n/a
8 TRCN0000015636 GTAACGATTGTGCGTCCCAAA pLKO.1 3150 CDS 100% 4.050 5.670 N TSHZ3 n/a
9 TRCN0000218826 AGATACCACAGATAGCATTTA pLKO_005 4259 3UTR 100% 13.200 9.240 N TSHZ3 n/a
10 TRCN0000230691 TGCCAGCAAGCACGCTGTTAA pLKO_005 3367 CDS 100% 13.200 9.240 N TSHZ3 n/a
11 TRCN0000015634 CCAGCCCATAGACTTGACAAA pLKO.1 2578 CDS 100% 4.950 3.465 N TSHZ3 n/a
12 TRCN0000081704 CCGCTATTTCTACCACGTCAA pLKO.1 2551 CDS 100% 4.050 2.835 N Tshz3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020856.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12376 pDONR223 100% 83% 83% None 1_549del n/a
2 ccsbBroad304_12376 pLX_304 0% 83% 83% V5 1_549del n/a
3 TRCN0000478931 GCTCAAAGTGGATCAGTACATAAA pLX_317 15% 83% 83% V5 1_549del n/a
Download CSV