Transcript: Human NM_020992.4

Homo sapiens PDZ and LIM domain 1 (PDLIM1), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PDLIM1 (9124)
Length:
1431
CDS:
89..1078

Additional Resources:

NCBI RefSeq record:
NM_020992.4
NBCI Gene record:
PDLIM1 (9124)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020992.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158423 CGGCTCTAGCTAATTTATGTA pLKO.1 204 CDS 100% 5.625 7.875 N PDLIM1 n/a
2 TRCN0000297445 CGGCTCTAGCTAATTTATGTA pLKO_005 204 CDS 100% 5.625 7.875 N PDLIM1 n/a
3 TRCN0000161848 GAAACAGAAGGGCCATTTCTT pLKO.1 967 CDS 100% 5.625 3.938 N PDLIM1 n/a
4 TRCN0000161214 GAAGCGTCATCCATACAAGAT pLKO.1 379 CDS 100% 4.950 3.465 N PDLIM1 n/a
5 TRCN0000163210 GCTCAGAAGTTGCCTATGTGT pLKO.1 848 CDS 100% 3.000 2.100 N PDLIM1 n/a
6 TRCN0000297187 GCTCAGAAGTTGCCTATGTGT pLKO_005 848 CDS 100% 3.000 2.100 N PDLIM1 n/a
7 TRCN0000161271 GCCTTGGTTAATTGACTCACA pLKO.1 1217 3UTR 100% 2.640 1.848 N PDLIM1 n/a
8 TRCN0000297446 GCCTTGGTTAATTGACTCACA pLKO_005 1217 3UTR 100% 2.640 1.848 N PDLIM1 n/a
9 TRCN0000161272 GCGTCATCCATACAAGATGAA pLKO.1 382 CDS 100% 0.495 0.347 N PDLIM1 n/a
10 TRCN0000161426 GCCTTGTCATCGACAAAGAAT pLKO.1 648 CDS 100% 5.625 3.375 N PDLIM1 n/a
11 TRCN0000278355 GCCTTGTCATCGACAAAGAAT pLKO_005 648 CDS 100% 5.625 3.375 N PDLIM1 n/a
12 TRCN0000159787 GTTCTCTGCTTACTTTGGTTT pLKO.1 1162 3UTR 100% 4.950 2.970 N PDLIM1 n/a
13 TRCN0000278365 GTTCTCTGCTTACTTTGGTTT pLKO_005 1162 3UTR 100% 4.950 2.970 N PDLIM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020992.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02086 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02086 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481128 GAGTCATCTCGAAACACTTTATCC pLX_317 44.9% 100% 100% V5 n/a
Download CSV