Transcript: Human NM_021012.5

Homo sapiens potassium inwardly rectifying channel subfamily J member 12 (KCNJ12), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KCNJ12 (3768)
Length:
5263
CDS:
736..2037

Additional Resources:

NCBI RefSeq record:
NM_021012.5
NBCI Gene record:
KCNJ12 (3768)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021012.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437768 TGCAACGGCCTCAGAAGTTTG pLKO_005 2178 3UTR 100% 10.800 7.560 N KCNJ12 n/a
2 TRCN0000429020 TCACCATCTTGCATGAGATTG pLKO_005 1538 CDS 100% 10.800 6.480 N KCNJ12 n/a
3 TRCN0000044520 CAACATTGAGTTCGCCAACAT pLKO.1 894 CDS 100% 4.950 2.970 N KCNJ12 n/a
4 TRCN0000044521 GCGGTACATGCTGCTCATCTT pLKO.1 975 CDS 100% 4.950 2.970 N KCNJ12 n/a
5 TRCN0000044518 CAACTCCTTCTGCTACGAGAA pLKO.1 1851 CDS 100% 4.050 2.430 N KCNJ12 n/a
6 TRCN0000434400 TCATCGACTCCTTCATGATTG pLKO_005 1247 CDS 100% 10.800 5.400 Y KCNJ12 n/a
7 TRCN0000044519 GAACCAGTACAAGATTGACTA pLKO.1 1740 CDS 100% 4.950 2.475 Y KCNJ12 n/a
8 TRCN0000044522 TCGCACTTCCACAAGACCTAT pLKO.1 1762 CDS 100% 4.950 2.475 Y KCNJ12 n/a
9 TRCN0000437169 CATCGATGTGGGCTTCGACAA pLKO_005 1485 CDS 100% 4.050 2.025 Y KCNJ12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021012.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00896 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00896 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481122 AACCCGACGGTCGGCATGCGTTCA pLX_317 24.9% 100% 100% V5 n/a
Download CSV