Transcript: Human NM_021136.3

Homo sapiens reticulon 1 (RTN1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
RTN1 (6252)
Length:
3239
CDS:
147..2477

Additional Resources:

NCBI RefSeq record:
NM_021136.3
NBCI Gene record:
RTN1 (6252)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021136.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427336 TTCCAACACACACAACGTAAA pLKO_005 2946 3UTR 100% 10.800 15.120 N RTN1 n/a
2 TRCN0000183306 GCAAAGGGATTATCGTATGAA pLKO.1 1233 CDS 100% 5.625 7.875 N RTN1 n/a
3 TRCN0000183412 CGTGGCTTATTTAGTTCTGAT pLKO.1 621 CDS 100% 4.950 6.930 N RTN1 n/a
4 TRCN0000179231 GCTCTGATGCAATAGTGGAAA pLKO.1 2844 3UTR 100% 4.950 6.930 N RTN1 n/a
5 TRCN0000432929 GACACTGACATCTCAATTAAA pLKO_005 822 CDS 100% 15.000 10.500 N RTN1 n/a
6 TRCN0000146278 CGTGTTACACATCTCTCATTT pLKO.1 454 CDS 100% 13.200 9.240 N RTN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021136.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11113 pDONR223 100% 90.3% 90.4% None 1_222del;2106C>T;2322T>C n/a
2 ccsbBroad304_11113 pLX_304 0% 90.3% 90.4% V5 1_222del;2106C>T;2322T>C n/a
3 ccsbBroadEn_11112 pDONR223 100% 24.8% 24.4% None (many diffs) n/a
4 ccsbBroad304_11112 pLX_304 0% 24.8% 24.4% V5 (many diffs) n/a
5 TRCN0000470254 CCCCTCTTGGAGGTTCAATCCCAT pLX_317 57.8% 24.8% 24.4% V5 (many diffs) n/a
Download CSV