Transcript: Human NM_021227.4

Homo sapiens oligosaccharyltransferase complex non-catalytic subunit (OSTC), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
OSTC (58505)
Length:
1062
CDS:
58..507

Additional Resources:

NCBI RefSeq record:
NM_021227.4
NBCI Gene record:
OSTC (58505)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021227.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135378 GTCGGTTCTATGACTGATGAA pLKO.1 232 CDS 100% 4.950 6.930 N OSTC n/a
2 TRCN0000133728 GCTGTACCAATCCTCTAATAT pLKO.1 568 3UTR 100% 15.000 9.000 N OSTC n/a
3 TRCN0000135188 CAGCTTTACCTATGGTGCTTT pLKO.1 932 3UTR 100% 4.950 2.970 N OSTC n/a
4 TRCN0000134823 CCTACAGAGTAAATGGACAAT pLKO.1 284 CDS 100% 4.950 2.970 N OSTC n/a
5 TRCN0000135203 CGTCTGTGTCCTATTGAGTTT pLKO.1 432 CDS 100% 4.950 2.970 N OSTC n/a
6 TRCN0000135791 CCAATGATGTTGAGTGGCATT pLKO.1 737 3UTR 100% 4.050 2.430 N OSTC n/a
7 TRCN0000136116 GCCTACAGAGTAAATGGACAA pLKO.1 283 CDS 100% 4.050 2.430 N OSTC n/a
8 TRCN0000135655 GTTTCATAATCCTGGACCGAT pLKO.1 356 CDS 100% 2.640 1.584 N OSTC n/a
9 TRCN0000128594 GAATGCACCAAATATCCCAAA pLKO.1 378 CDS 100% 4.050 2.025 Y OSTCP1 n/a
10 TRCN0000135790 CGAATGCACCAAATATCCCAA pLKO.1 377 CDS 100% 2.640 1.320 Y OSTC n/a
11 TRCN0000134376 GATGTTATTGTTGAACCTCCA pLKO.1 208 CDS 100% 2.160 1.080 Y OSTC n/a
12 TRCN0000146700 GATGTTATTGTTGAACCTCCA pLKO.1 208 CDS 100% 2.160 1.080 Y OSTCP1 n/a
13 TRCN0000128498 GCTCCTGTCAATGAAGTTTAA pLKO.1 544 3UTR 100% 13.200 6.600 Y OSTCP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021227.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03865 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03865 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466811 CACCATCTTCCTCTACTAGCAACA pLX_317 98.7% 100% 100% V5 n/a
4 ccsbBroadEn_10576 pDONR223 100% 75.3% 73.1% None (many diffs) n/a
5 ccsbBroad304_10576 pLX_304 0% 75.3% 73.1% V5 (many diffs) n/a
Download CSV