Transcript: Mouse NM_021424.2

Mus musculus nectin cell adhesion molecule 1 (Nectin1), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Nectin1 (58235)
Length:
5079
CDS:
69..1616

Additional Resources:

NCBI RefSeq record:
NM_021424.2
NBCI Gene record:
Nectin1 (58235)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271927 GGGACTGCTAGCGTCTCATAT pLKO_005 2800 3UTR 100% 13.200 18.480 N Nectin1 n/a
2 TRCN0000284549 GTCCTGGGAAACACGGCTAAA pLKO_005 617 CDS 100% 10.800 15.120 N Nectin1 n/a
3 TRCN0000271884 GCCATCTACAACCCGACTATG pLKO_005 303 CDS 100% 10.800 8.640 N Nectin1 n/a
4 TRCN0000109447 CTTACGCTCAACGTGCAGTAT pLKO.1 783 CDS 100% 4.950 3.960 N Nectin1 n/a
5 TRCN0000109445 CCCTCATTCTAAATGGGCATT pLKO.1 3121 3UTR 100% 4.050 3.240 N Nectin1 n/a
6 TRCN0000109448 GTACCACTGGACCACATTGAA pLKO.1 905 CDS 100% 0.000 0.000 N Nectin1 n/a
7 TRCN0000271883 TGGCCTGCATTGTCAACTATC pLKO_005 739 CDS 100% 10.800 7.560 N Nectin1 n/a
8 TRCN0000109449 ACGCTCAACGTGCAGTATGAA pLKO.1 786 CDS 100% 5.625 3.938 N Nectin1 n/a
9 TRCN0000062933 CGACTCCATGTATGGCTTCAT pLKO.1 176 CDS 100% 4.950 3.465 N NECTIN1 n/a
10 TRCN0000109446 CGACGGGTCTTTCATTTCCAA pLKO.1 1577 CDS 100% 3.000 2.100 N Nectin1 n/a
11 TRCN0000373346 GCACCAAGAAGCACGTGTATG pLKO_005 1234 CDS 100% 10.800 6.480 N NECTIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01349 pDONR223 100% 90.2% 94.5% None (many diffs) n/a
2 ccsbBroad304_01349 pLX_304 0% 90.2% 94.5% V5 (many diffs) n/a
3 TRCN0000473295 GTGGCACATAAACTATTTCCTATC pLX_317 13.9% 90.2% 94.5% V5 (many diffs) n/a
Download CSV