Transcript: Mouse NM_021431.2

Mus musculus nudix (nucleoside diphosphate linked moiety X)-type motif 11 (Nudt11), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Nudt11 (58242)
Length:
2649
CDS:
405..899

Additional Resources:

NCBI RefSeq record:
NM_021431.2
NBCI Gene record:
Nudt11 (58242)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021431.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081508 CGGACTTAATTCAGCACCTAT pLKO.1 1100 3UTR 100% 4.950 3.465 N Nudt11 n/a
2 TRCN0000177917 CAAGATCGAAGATGCCATCAA pLKO.1 764 CDS 100% 4.950 2.475 Y Nudt10 n/a
3 TRCN0000081509 GAGTGGTTCAAGATCGAAGAT pLKO.1 756 CDS 100% 4.950 2.475 Y Nudt11 n/a
4 TRCN0000178415 GTTCAAGATCGAAGATGCCAT pLKO.1 761 CDS 100% 2.640 1.320 Y Nudt10 n/a
5 TRCN0000081510 CACGCCGAGTACCTGGAGAAA pLKO.1 810 CDS 100% 1.650 0.825 Y Nudt11 n/a
6 TRCN0000081512 GCACCGGACCTACGTGTTCGT pLKO.1 674 CDS 100% 0.000 0.000 Y Nudt11 n/a
7 TRCN0000081511 GCTGGGCGTCTTCGAGCAGAA pLKO.1 641 CDS 100% 0.000 0.000 Y Nudt11 n/a
8 TRCN0000200436 GTACCTGGAGAAACTGAAGCT pLKO.1 818 CDS 100% 0.000 0.000 Y Nudt10 n/a
9 TRCN0000312588 ATCTGGTGCTAGTAGAGTATA pLKO_005 1306 3UTR 100% 13.200 10.560 N NUDT11 n/a
10 TRCN0000050306 TGCTGGAGGATTGGGAAGATT pLKO.1 712 CDS 100% 5.625 2.813 Y NUDT11 n/a
11 TRCN0000327651 TGCTGGAGGATTGGGAAGATT pLKO_005 712 CDS 100% 5.625 2.813 Y NUDT11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021431.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16119 pDONR223 0% 88% 94.5% None (many diffs) n/a
2 ccsbBroad304_16119 pLX_304 0% 88% 94.5% V5 (many diffs) n/a
3 TRCN0000468380 TTCAACATATTGCCGCGCTGGCAA pLX_317 79.2% 88% 94.5% V5 (many diffs) n/a
4 ccsbBroadEn_09782 pDONR223 100% 87.6% 94.5% None (many diffs) n/a
5 ccsbBroad304_09782 pLX_304 0% 87.6% 94.5% V5 (many diffs) n/a
6 TRCN0000471165 TCGTGAAGCGCCATCCACTGCGAA pLX_317 92.3% 87.6% 94.5% V5 (many diffs) n/a
7 ccsbBroadEn_08486 pDONR223 100% 87.6% 94.5% None (many diffs) n/a
8 ccsbBroad304_08486 pLX_304 0% 87.6% 94.5% V5 (many diffs) n/a
9 TRCN0000471707 AATGTGCACGACCTAGGGATGGTG pLX_317 55% 87.6% 94.5% V5 (many diffs) n/a
Download CSV