Transcript: Mouse NM_021450.2

Mus musculus transient receptor potential cation channel, subfamily M, member 7 (Trpm7), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Trpm7 (58800)
Length:
7145
CDS:
286..5877

Additional Resources:

NCBI RefSeq record:
NM_021450.2
NBCI Gene record:
Trpm7 (58800)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023956 CCTGGTATAAGGTCATATTAA pLKO.1 2555 CDS 100% 15.000 21.000 N Trpm7 n/a
2 TRCN0000274711 CTAGACTTTCTAGCCGTAAAT pLKO_005 3214 CDS 100% 13.200 18.480 N Trpm7 n/a
3 TRCN0000023958 CCTTATCAAACCCTATTGAAT pLKO.1 955 CDS 100% 5.625 4.500 N Trpm7 n/a
4 TRCN0000274712 CCTTATCAAACCCTATTGAAT pLKO_005 955 CDS 100% 5.625 4.500 N Trpm7 n/a
5 TRCN0000274774 ATGGATTGTTATCGCTTATAT pLKO_005 2943 CDS 100% 15.000 10.500 N Trpm7 n/a
6 TRCN0000274772 ACCTGGTGCAGGACCATTAAC pLKO_005 6129 3UTR 100% 13.200 9.240 N Trpm7 n/a
7 TRCN0000023954 CCAAAGATCAAGAACCCATTT pLKO.1 4538 CDS 100% 10.800 7.560 N Trpm7 n/a
8 TRCN0000274773 CCAAAGATCAAGAACCCATTT pLKO_005 4538 CDS 100% 10.800 7.560 N Trpm7 n/a
9 TRCN0000021561 GCCAATATGTTCTACATTGTA pLKO.1 3277 CDS 100% 5.625 3.938 N TRPM7 n/a
10 TRCN0000318838 GCCAATATGTTCTACATTGTA pLKO_005 3277 CDS 100% 5.625 3.938 N TRPM7 n/a
11 TRCN0000023957 CCTCAGGATGAGTCATCAGAT pLKO.1 5788 CDS 100% 4.950 3.465 N Trpm7 n/a
12 TRCN0000023955 GCTCAGAATCTTATTGATGAT pLKO.1 4108 CDS 100% 4.950 3.465 N Trpm7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15081 pDONR223 25.9% 87.9% 12% None (many diffs) n/a
2 ccsbBroad304_15081 pLX_304 0% 87.9% 12% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV