Transcript: Mouse NM_021494.1

Mus musculus DENN/MADD domain containing 5A (Dennd5a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Dennd5a (19347)
Length:
4972
CDS:
241..4104

Additional Resources:

NCBI RefSeq record:
NM_021494.1
NBCI Gene record:
Dennd5a (19347)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110186 CCCGTCAAAGAGGTCTTTGAA pLKO.1 1093 CDS 100% 0.563 0.788 N Dennd5a n/a
2 TRCN0000110188 CCATGATAATTCTGGGCTGTA pLKO.1 3282 CDS 100% 4.050 3.240 N Dennd5a n/a
3 TRCN0000110189 GCTCAGGATTTACCAGCTAAA pLKO.1 1758 CDS 100% 10.800 7.560 N Dennd5a n/a
4 TRCN0000110187 GCCAGTACATTCAGGCTTCTA pLKO.1 356 CDS 100% 4.950 3.465 N Dennd5a n/a
5 TRCN0000110185 GCACAAAGTTGCACAGGAGTA pLKO.1 4717 3UTR 100% 4.050 2.835 N Dennd5a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11706 pDONR223 100% 60.9% 66.2% None (many diffs) n/a
2 ccsbBroad304_11706 pLX_304 0% 60.9% 66.2% V5 (many diffs) n/a
3 TRCN0000467580 AGCCGGAGACTTCGGGGAAAGCCT pLX_317 15.3% 60.9% 66.2% V5 (many diffs) n/a
Download CSV