Transcript: Human NM_021616.6

Homo sapiens tripartite motif containing 34 (TRIM34), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TRIM34 (53840)
Length:
2293
CDS:
138..1604

Additional Resources:

NCBI RefSeq record:
NM_021616.6
NBCI Gene record:
TRIM34 (53840)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021616.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415234 AGTTATGAGAGATGCTTATTT pLKO_005 1751 3UTR 100% 15.000 7.500 Y TRIM34 n/a
2 TRCN0000153814 CCTTGTGGTTTCCCTTCTTTA pLKO.1 1688 3UTR 100% 13.200 6.600 Y TRIM6-TRIM34 n/a
3 TRCN0000150702 CAAGTGATATCTGTGCCAATT pLKO.1 1101 CDS 100% 10.800 5.400 Y TRIM6-TRIM34 n/a
4 TRCN0000005894 GCAGGACATGAGTGGAATCAT pLKO.1 884 CDS 100% 5.625 2.813 Y TRIM34 n/a
5 TRCN0000005892 CGGAGGAAGTATTCAAGGAAT pLKO.1 535 CDS 100% 4.950 2.475 Y TRIM34 n/a
6 TRCN0000010970 GCCTTCCCATTTATCCATGTT pLKO.1 1853 3UTR 100% 4.950 2.475 Y TRIM34 n/a
7 TRCN0000005895 GTGTGGTATCAGTTACTCATT pLKO.1 311 CDS 100% 4.950 2.475 Y TRIM34 n/a
8 TRCN0000151526 CATTTGAACATCTACAGGCTA pLKO.1 328 CDS 100% 2.640 1.320 Y TRIM6-TRIM34 n/a
9 TRCN0000005893 CGCCATATGAAGTATGTTGTT pLKO.1 1251 CDS 100% 0.000 0.000 Y TRIM34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021616.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05690 pDONR223 100% 57.9% 57.9% None 0_1ins1062 n/a
2 ccsbBroad304_05690 pLX_304 0% 57.9% 57.9% V5 0_1ins1062 n/a
3 TRCN0000477088 ATACACCGAAGCTAGGTACGCAAA pLX_317 15% 57.9% 57.9% V5 0_1ins1062 n/a
Download CSV