Transcript: Human NM_021923.3

Homo sapiens fibroblast growth factor receptor like 1 (FGFRL1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
FGFRL1 (53834)
Length:
3105
CDS:
23..1537

Additional Resources:

NCBI RefSeq record:
NM_021923.3
NBCI Gene record:
FGFRL1 (53834)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149175 GATGGCCGCACCATCCACAG pXPR_003 CGG 212 14% 2 0.5177 FGFRL1 FGFRL1 76976
2 BRDN0001145508 CGCGACCACACGTCACCCGT pXPR_003 GGG 924 61% 5 0.5054 FGFRL1 FGFRL1 76975
3 BRDN0001147067 CGACTAACCCAGCACGACGA pXPR_003 GGG 343 23% 2 -0.0420 FGFRL1 FGFRL1 76977
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021923.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358948 CGACGGCTCCTACCTCAATAA pLKO_005 967 CDS 100% 13.200 18.480 N FGFRL1 n/a
2 TRCN0000060825 CTACCTCAATAAGCTGCTCAT pLKO.1 976 CDS 100% 4.050 5.670 N FGFRL1 n/a
3 TRCN0000060824 GCACATCCACTATCAGTGCTA pLKO.1 1516 CDS 100% 2.640 3.696 N FGFRL1 n/a
4 TRCN0000060826 GCCCGACATCACGTGGATGAA pLKO.1 559 CDS 100% 1.650 2.310 N FGFRL1 n/a
5 TRCN0000060827 CGTGAACACGACGGTGGACTT pLKO.1 781 CDS 100% 1.350 1.890 N FGFRL1 n/a
6 TRCN0000358946 GACGCACACACGTGCAGATAT pLKO_005 1949 3UTR 100% 13.200 17.160 N FGFRL1 n/a
7 TRCN0000359030 CACACACATGCACGGATATTG pLKO_005 2031 3UTR 100% 13.200 9.240 N FGFRL1 n/a
8 TRCN0000359031 TCGTCGTGCTGGATGACATTA pLKO_005 363 CDS 100% 13.200 9.240 N FGFRL1 n/a
9 TRCN0000060823 CCTGGACACACACACAGATAA pLKO.1 2285 3UTR 100% 13.200 7.920 N FGFRL1 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1457 CDS 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021923.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03396 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03396 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465318 TAAAACCAATTAGCCTCCCGTGAG pLX_317 5.4% 100% 100% V5 n/a
4 ccsbBroadEn_15078 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_15078 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000468902 TGCGTTATCAATCCAACCAGAGTG pLX_317 13.7% 100% 100% V5 n/a
7 ccsbBroadEn_12026 pDONR223 100% 69.3% 69.2% None 1_462del;1085C>A n/a
8 ccsbBroad304_12026 pLX_304 0% 69.3% 69.2% V5 1_462del;1085C>A n/a
9 TRCN0000479989 GTGTTCTATATCCATCTATCCCTC pLX_317 15.8% 69.3% 69.2% V5 1_462del;1085C>A n/a
Download CSV