Transcript: Human NM_021937.5

Homo sapiens eukaryotic elongation factor, selenocysteine-tRNA specific (EEFSEC), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
EEFSEC (60678)
Length:
2205
CDS:
28..1818

Additional Resources:

NCBI RefSeq record:
NM_021937.5
NBCI Gene record:
EEFSEC (60678)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021937.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234642 TTCCGAGGTGCACCGATTATA pLKO_005 553 CDS 100% 15.000 21.000 N EEFSEC n/a
2 TRCN0000154374 CAGATTTCCATCCCAACGAGA pLKO.1 661 CDS 100% 2.640 3.696 N EEFSEC n/a
3 TRCN0000234641 GAGACAGGCAGCAATTGATAA pLKO_005 492 CDS 100% 13.200 9.240 N EEFSEC n/a
4 TRCN0000234644 AGCCTGACTTTCAAGCGTTAT pLKO_005 1759 CDS 100% 10.800 7.560 N EEFSEC n/a
5 TRCN0000234643 AGGGCATTCCAGAGCTCATTG pLKO_005 626 CDS 100% 10.800 7.560 N EEFSEC n/a
6 TRCN0000153574 GATGGATGACTACAGTGTGAT pLKO.1 1473 CDS 100% 4.950 3.465 N EEFSEC n/a
7 TRCN0000154327 CGGCAAGTTCAAGATCCACAT pLKO.1 1602 CDS 100% 4.050 2.835 N EEFSEC n/a
8 TRCN0000154862 GAAGACCCTAGAGAACACCAA pLKO.1 531 CDS 100% 2.640 1.848 N EEFSEC n/a
9 TRCN0000155280 GATAACTTTGACCAGGAGCCT pLKO.1 1093 CDS 100% 0.660 0.462 N EEFSEC n/a
10 TRCN0000151741 CCAGATCATTGATCTGATGAT pLKO.1 348 CDS 100% 0.495 0.347 N EEFSEC n/a
11 TRCN0000234645 TGCTGTGCCAAATCCCAACCA pLKO_005 1867 3UTR 100% 2.640 1.584 N EEFSEC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021937.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000477372 AACGCCATTCTTCTCATAGTACCG pLX_317 24.6% 94.6% 94.1% V5 (many diffs) n/a
Download CSV