Transcript: Human NM_021940.5

Homo sapiens small ArfGAP 1 (SMAP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SMAP1 (60682)
Length:
3133
CDS:
142..1464

Additional Resources:

NCBI RefSeq record:
NM_021940.5
NBCI Gene record:
SMAP1 (60682)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021940.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152198 CCTGTTCAAGTCTACCAATTA pLKO.1 2445 3UTR 100% 13.200 18.480 N SMAP1 n/a
2 TRCN0000152606 GAACGATGATCTGGACATCTT pLKO.1 777 CDS 100% 4.950 3.960 N SMAP1 n/a
3 TRCN0000106067 CCTGGAATATTGGTGTGTTTA pLKO.1 275 CDS 100% 13.200 9.240 N Smap1 n/a
4 TRCN0000151488 CCTGGAATATTGGTGTGTTTA pLKO.1 275 CDS 100% 13.200 9.240 N SMAP1 n/a
5 TRCN0000153718 CAACCCTGTCTACAGTAACAT pLKO.1 875 CDS 100% 5.625 3.938 N SMAP1 n/a
6 TRCN0000151136 GCTGTTGTTATGATGTGCTTA pLKO.1 1967 3UTR 100% 4.950 3.465 N SMAP1 n/a
7 TRCN0000150993 CCGATGATTTCTAATCCCTTA pLKO.1 802 CDS 100% 4.050 2.835 N SMAP1 n/a
8 TRCN0000153098 GCATGAGTATCAGTAGTGCAA pLKO.1 1349 CDS 100% 2.640 1.848 N SMAP1 n/a
9 TRCN0000151035 GCAGCACAAGTGTAATGAATA pLKO.1 2938 3UTR 100% 13.200 7.920 N SMAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021940.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03898 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03898 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473516 CGTTTAATGGTTTGATCGATGTCC pLX_317 37.2% 100% 100% V5 n/a
Download CSV