Transcript: Human NM_021965.4

Homo sapiens phosphoglucomutase 5 (PGM5), mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
PGM5 (5239)
Length:
3626
CDS:
518..2221

Additional Resources:

NCBI RefSeq record:
NM_021965.4
NBCI Gene record:
PGM5 (5239)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021965.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000455014 CCGAGATCACTGGGCCAAATT pLKO_005 1771 CDS 100% 13.200 18.480 N PGM5 n/a
2 TRCN0000049060 CGTGGCGAAGACGGATAGTTT pLKO.1 1933 CDS 100% 5.625 7.875 N PGM5 n/a
3 TRCN0000049058 CGCCACTACTATTGCAGGTTT pLKO.1 1796 CDS 100% 4.950 6.930 N PGM5 n/a
4 TRCN0000049062 CCTGGTCACAGACAAATCCTT pLKO.1 1873 CDS 100% 3.000 2.100 N PGM5 n/a
5 TRCN0000049059 GCCAAATCAATGAAGGTCCCT pLKO.1 1565 CDS 100% 0.660 0.462 N PGM5 n/a
6 TRCN0000049099 CCCAGCCAATTCTGCAATAAA pLKO.1 1261 CDS 100% 15.000 7.500 Y PGM5P1 n/a
7 TRCN0000049102 CCTCTCTTGCATTCCATATTT pLKO.1 1480 CDS 100% 15.000 7.500 Y PGM5P1 n/a
8 TRCN0000049101 CCTGACCCAAACCTGACATAT pLKO.1 1316 CDS 100% 13.200 6.600 Y PGM5P1 n/a
9 TRCN0000049061 CGACTGATTATTGGACAGAAT pLKO.1 785 CDS 100% 4.950 2.475 Y PGM5 n/a
10 TRCN0000200822 GTGAAGTTTAATGTTGCCAAT pLKO.1 917 CDS 100% 4.050 2.025 Y Pgm5 n/a
11 TRCN0000413827 GCAACTACCTGCCCAACTTCA pLKO_005 630 CDS 100% 4.950 2.475 Y Pgm5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021965.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13919 pDONR223 100% 57.2% 56.9% None (many diffs) n/a
2 ccsbBroad304_13919 pLX_304 0% 57.2% 56.9% V5 (many diffs) n/a
3 TRCN0000475957 AAGTCTTGGATCATGTTCTGTATA pLX_317 30.8% 57.2% 56.9% V5 (many diffs) n/a
Download CSV