Transcript: Mouse NM_022023.2

Mus musculus glia maturation factor, beta (Gmfb), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Gmfb (63985)
Length:
4171
CDS:
140..568

Additional Resources:

NCBI RefSeq record:
NM_022023.2
NBCI Gene record:
Gmfb (63985)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294772 TCGTACCCGCTCTGCTTTATT pLKO_005 386 CDS 100% 15.000 21.000 N Gmfb n/a
2 TRCN0000294771 TTACGTGAGAAACTTGGATTT pLKO_005 539 CDS 100% 10.800 15.120 N Gmfb n/a
3 TRCN0000002500 CGCTTCATTGTGTATAGTTAT pLKO.1 338 CDS 100% 13.200 10.560 N GMFB n/a
4 TRCN0000293493 CGCTTCATTGTGTATAGTTAT pLKO_005 338 CDS 100% 13.200 10.560 N GMFB n/a
5 TRCN0000108770 CGCTTATGATAGAAACAGTTT pLKO.1 3859 3UTR 100% 4.950 3.960 N Gmfb n/a
6 TRCN0000108773 CCCACAATGCTGCTATTATAA pLKO.1 219 CDS 100% 15.000 10.500 N Gmfb n/a
7 TRCN0000307410 CTATAGGAAGGTGGGTATTAG pLKO_005 868 3UTR 100% 13.200 9.240 N Gmfb n/a
8 TRCN0000294833 TGTCTCTCCAGATGAACTTAA pLKO_005 292 CDS 100% 13.200 9.240 N Gmfb n/a
9 TRCN0000108772 CCTCGCTTCATTGTGTATAGT pLKO.1 335 CDS 100% 5.625 3.938 N Gmfb n/a
10 TRCN0000108774 CGAGCTAACCAAGGTATTTGA pLKO.1 484 CDS 100% 5.625 3.938 N Gmfb n/a
11 TRCN0000287329 CGAGCTAACCAAGGTATTTGA pLKO_005 484 CDS 100% 5.625 3.938 N Gmfb n/a
12 TRCN0000002499 GAAGAATGGTTACGTGAGAAA pLKO.1 530 CDS 100% 4.950 3.465 N GMFB n/a
13 TRCN0000293492 GAAGAATGGTTACGTGAGAAA pLKO_005 530 CDS 100% 4.950 3.465 N GMFB n/a
14 TRCN0000108771 GCTGGGAGTAAGAACAAGCTA pLKO.1 452 CDS 100% 3.000 2.100 N Gmfb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10849 pDONR223 100% 83.5% 89.6% None (many diffs) n/a
2 ccsbBroad304_10849 pLX_304 0% 83.5% 89.6% V5 (many diffs) n/a
3 TRCN0000466572 TTTACATGGTTTTCAGCCCCTTGA pLX_317 98.7% 83.5% 89.6% V5 (many diffs) n/a
Download CSV