Transcript: Human NM_022072.5

Homo sapiens NOP2/Sun RNA methyltransferase 3 (NSUN3), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
NSUN3 (63899)
Length:
6431
CDS:
67..1089

Additional Resources:

NCBI RefSeq record:
NM_022072.5
NBCI Gene record:
NSUN3 (63899)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022072.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152532 GCCCAATGTATGTAGCCAAAT pLKO.1 1037 CDS 100% 10.800 15.120 N NSUN3 n/a
2 TRCN0000152023 CTTAGAATCTAGGCTTGAGAA pLKO.1 1223 3UTR 100% 4.950 6.930 N NSUN3 n/a
3 TRCN0000150339 CCACAGCCTTTGATAAATGTA pLKO.1 604 CDS 100% 5.625 4.500 N NSUN3 n/a
4 TRCN0000153356 GCATCCTGTAGGATAAGTCAA pLKO.1 751 CDS 100% 4.950 3.960 N NSUN3 n/a
5 TRCN0000150823 GCTGTTAAGGTCTGCAATTAA pLKO.1 801 CDS 100% 15.000 10.500 N NSUN3 n/a
6 TRCN0000271458 ACACTCTCTCAGGGATCTTTA pLKO_005 292 CDS 100% 13.200 9.240 N NSUN3 n/a
7 TRCN0000271505 AGTGTTGGCTCTGGAATTAAG pLKO_005 435 CDS 100% 13.200 9.240 N NSUN3 n/a
8 TRCN0000271503 CAAAGTTGTGTTGGATCATTT pLKO_005 120 CDS 100% 13.200 9.240 N NSUN3 n/a
9 TRCN0000271504 GGTCTGTTTGGAATCCTATTT pLKO_005 1185 3UTR 100% 13.200 9.240 N NSUN3 n/a
10 TRCN0000271459 TCCTGCTTAACCGATTCAATT pLKO_005 227 CDS 100% 13.200 9.240 N NSUN3 n/a
11 TRCN0000154203 CCAGCCTGAAATGTTTGACAA pLKO.1 666 CDS 100% 4.950 3.465 N NSUN3 n/a
12 TRCN0000158374 CCACGGTAACATCATGCCTAT pLKO.1 912 CDS 100% 4.050 2.835 N NSUN3 n/a
13 TRCN0000151832 CTTGAGAATTGTTCAGGTGTA pLKO.1 1236 3UTR 100% 4.050 2.835 N NSUN3 n/a
14 TRCN0000152726 CGTGTTCAAATGATCGAAGCT pLKO.1 704 CDS 100% 2.640 1.848 N NSUN3 n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2558 3UTR 100% 13.200 6.600 Y LIAS n/a
16 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4610 3UTR 100% 5.625 2.813 Y KLHL30 n/a
17 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 4409 3UTR 100% 4.950 2.475 Y CCNJL n/a
18 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 4367 3UTR 100% 0.495 0.248 Y C11orf44 n/a
19 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4610 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022072.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08811 pDONR223 100% 99.9% 99.7% None 884C>T n/a
2 ccsbBroad304_08811 pLX_304 0% 99.9% 99.7% V5 884C>T n/a
Download CSV