Transcript: Human NM_022128.3

Homo sapiens ribokinase (RBKS), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
RBKS (64080)
Length:
1247
CDS:
43..1011

Additional Resources:

NCBI RefSeq record:
NM_022128.3
NBCI Gene record:
RBKS (64080)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010048 GACCTTCCGCTTACTCTGTTT pLKO.1 988 CDS 100% 4.950 6.930 N RBKS n/a
2 TRCN0000195544 CATAGTGGCTGGAGCAAATTT pLKO.1 408 CDS 100% 15.000 10.500 N RBKS n/a
3 TRCN0000279958 CATAGTGGCTGGAGCAAATTT pLKO_005 408 CDS 100% 15.000 10.500 N RBKS n/a
4 TRCN0000078934 TCAATAATGAAGGCCAGAATA pLKO.1 380 CDS 100% 13.200 9.240 N Rbks n/a
5 TRCN0000197096 GAAACCATCCATGGACATAAG pLKO.1 160 CDS 100% 10.800 7.560 N RBKS n/a
6 TRCN0000279889 GAAACCATCCATGGACATAAG pLKO_005 160 CDS 100% 10.800 7.560 N RBKS n/a
7 TRCN0000010047 ACAGTCATCTTACCCTTACAA pLKO.1 963 CDS 100% 5.625 3.938 N RBKS n/a
8 TRCN0000199478 GCCTTCTACCTGGCTTACTAT pLKO.1 868 CDS 100% 5.625 3.938 N RBKS n/a
9 TRCN0000196659 GCTCAACAGATCCAATTTCAT pLKO.1 912 CDS 100% 5.625 3.938 N RBKS n/a
10 TRCN0000279888 GCTCAACAGATCCAATTTCAT pLKO_005 912 CDS 100% 5.625 3.938 N RBKS n/a
11 TRCN0000010045 CTCGAAATAACTCCAGCAACT pLKO.1 499 CDS 100% 4.050 2.835 N RBKS n/a
12 TRCN0000010044 TCTTACTTCTCGTTTGCCAAA pLKO.1 132 CDS 100% 4.050 2.835 N RBKS n/a
13 TRCN0000279831 TCTTACTTCTCGTTTGCCAAA pLKO_005 132 CDS 100% 4.050 2.835 N RBKS n/a
14 TRCN0000010046 TCCCACAGAGAAAGTCAAGGC pLKO.1 804 CDS 100% 2.160 1.512 N RBKS n/a
15 TRCN0000297337 TCCCACAGAGAAAGTCAAGGC pLKO_005 804 CDS 100% 2.160 1.512 N RBKS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03917 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03917 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471252 CTCAGGCCATGTATTGCCCTAGCC pLX_317 40.8% 100% 100% V5 n/a
4 ccsbBroadEn_15130 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_15130 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000465506 AACGAACAACTGCCAGGCCTATTC pLX_317 22.9% 100% 100% V5 n/a
7 TRCN0000487709 AACACATCACCCTCCGACACTGCC pLX_317 23.5% 100% 100% V5 (not translated due to prior stop codon) n/a
8 TRCN0000489586 TCGTCCTTCCAATCCCGCGTAAGT pLX_317 22.3% 99.8% 99.6% V5 966_967insG n/a
9 TRCN0000487710 CAAGATAAGCGTCGGCCCTTGGTC pLX_317 23.5% 99.8% 100% V5 (not translated due to prior stop codon) 673T>C n/a
Download CSV