Transcript: Mouse NM_022331.1

Mus musculus homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 (Herpud1), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Herpud1 (64209)
Length:
1871
CDS:
93..1268

Additional Resources:

NCBI RefSeq record:
NM_022331.1
NBCI Gene record:
Herpud1 (64209)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022331.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173977 GTTCAGAACTTCCCGGATGAT pLKO.1 1035 CDS 100% 4.950 6.930 N Herpud1 n/a
2 TRCN0000279443 GTTCAGAACTTCCCGGATGAT pLKO_005 1035 CDS 100% 4.950 6.930 N Herpud1 n/a
3 TRCN0000194570 CCTCGTTTATGAGCACAGCAT pLKO.1 1183 CDS 100% 2.640 3.696 N Herpud1 n/a
4 TRCN0000194158 GCTCCTATACACAACCAGTTT pLKO.1 729 CDS 100% 4.950 3.960 N Herpud1 n/a
5 TRCN0000297670 GCTCCTATACACAACCAGTTT pLKO_005 729 CDS 100% 4.950 3.960 N Herpud1 n/a
6 TRCN0000193577 GTAGTTTCATAGGCACTGTAA pLKO.1 1494 3UTR 100% 4.950 3.960 N Herpud1 n/a
7 TRCN0000174295 CGTTATTCTGAAGAGCTTTAA pLKO.1 1461 3UTR 100% 13.200 9.240 N Herpud1 n/a
8 TRCN0000279511 CGTTATTCTGAAGAGCTTTAA pLKO_005 1461 3UTR 100% 13.200 9.240 N Herpud1 n/a
9 TRCN0000279512 GAGCAGCCGGACAACTCTAAT pLKO_005 408 CDS 100% 13.200 9.240 N Herpud1 n/a
10 TRCN0000279513 ACTGGTTGGATTGGACCTATT pLKO_005 880 CDS 100% 10.800 7.560 N Herpud1 n/a
11 TRCN0000175147 GCTAGTCTTCAAGACTTTCTT pLKO.1 1205 CDS 100% 5.625 3.938 N Herpud1 n/a
12 TRCN0000193720 CAATGTGAAGAATCCCTCCAA pLKO.1 350 CDS 100% 2.640 1.848 N Herpud1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022331.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02230 pDONR223 100% 86.5% 88.7% None (many diffs) n/a
2 ccsbBroad304_02230 pLX_304 0% 86.5% 88.7% V5 (many diffs) n/a
3 TRCN0000478840 CCTGATACCTTCCGGGCTCATCGC pLX_317 39.3% 86.5% 88.7% V5 (many diffs) n/a
Download CSV