Transcript: Human NM_022717.4

Homo sapiens small nuclear ribonucleoprotein U11/U12 subunit 35 (SNRNP35), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
SNRNP35 (11066)
Length:
1477
CDS:
82..822

Additional Resources:

NCBI RefSeq record:
NM_022717.4
NBCI Gene record:
SNRNP35 (11066)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022717.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276575 AGGGCAATGCTGGCACGATAT pLKO_005 178 CDS 100% 10.800 15.120 N SNRNP35 n/a
2 TRCN0000276573 GGGCTACGCCTTCATCGAATA pLKO_005 357 CDS 100% 10.800 15.120 N SNRNP35 n/a
3 TRCN0000151897 CCTATTAACTTGCCAGTTGTT pLKO.1 574 CDS 100% 4.950 3.960 N SNRNP35 n/a
4 TRCN0000276522 CCTATTAACTTGCCAGTTGTT pLKO_005 574 CDS 100% 4.950 3.960 N SNRNP35 n/a
5 TRCN0000285591 GAGTCTGGGCAACTGAGATTT pLKO_005 526 CDS 100% 13.200 9.240 N SNRNP35 n/a
6 TRCN0000156675 GATGCTGATGGCCTGGTTATT pLKO.1 412 CDS 100% 13.200 9.240 N SNRNP35 n/a
7 TRCN0000157215 GCAGACCAAGGAGGACAAATT pLKO.1 261 CDS 100% 13.200 9.240 N SNRNP35 n/a
8 TRCN0000153513 CTTCAGAGATGACAGGATCAA pLKO.1 771 CDS 100% 4.950 3.465 N SNRNP35 n/a
9 TRCN0000276524 CTTCAGAGATGACAGGATCAA pLKO_005 771 CDS 100% 4.950 3.465 N SNRNP35 n/a
10 TRCN0000151582 GCATGAGATATTTGTGGACTA pLKO.1 438 CDS 100% 4.050 2.835 N SNRNP35 n/a
11 TRCN0000152447 CAGACTAAACTTGCAGACCAA pLKO.1 249 CDS 100% 2.640 1.848 N SNRNP35 n/a
12 TRCN0000157288 CCAGACTAAACTTGCAGACCA pLKO.1 248 CDS 100% 2.640 1.848 N SNRNP35 n/a
13 TRCN0000156273 CCTGGTTATTGACCAGCATGA pLKO.1 423 CDS 100% 0.405 0.284 N SNRNP35 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1347 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1347 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022717.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02609 pDONR223 100% 98% 98% None 0_1insATGAAACCAGCTAAC n/a
2 ccsbBroad304_02609 pLX_304 0% 98% 98% V5 0_1insATGAAACCAGCTAAC n/a
3 TRCN0000477923 GAGATTATTCTGCCCGACCACTTT pLX_317 60% 98% 98% V5 0_1insATGAAACCAGCTAAC n/a
Download CSV