Transcript: Mouse NM_022997.4

Mus musculus VPS35 retromer complex component (Vps35), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Vps35 (65114)
Length:
3169
CDS:
41..2431

Additional Resources:

NCBI RefSeq record:
NM_022997.4
NBCI Gene record:
Vps35 (65114)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022997.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111555 CCACTTATTCTGGCTACTAAT pLKO.1 2685 3UTR 100% 13.200 18.480 N Vps35 n/a
2 TRCN0000318222 CCACTTATTCTGGCTACTAAT pLKO_005 2685 3UTR 100% 13.200 18.480 N Vps35 n/a
3 TRCN0000111556 CGTGTGGACTACGTCGATAAA pLKO.1 1133 CDS 100% 13.200 18.480 N Vps35 n/a
4 TRCN0000318220 CGTGTGGACTACGTCGATAAA pLKO_005 1133 CDS 100% 13.200 18.480 N Vps35 n/a
5 TRCN0000381116 ATCTCATGGAGTGCATCATTC pLKO_005 822 CDS 100% 10.800 15.120 N Vps35 n/a
6 TRCN0000111557 CCAAATCTTGAGTCCAGTGAA pLKO.1 2303 CDS 100% 4.950 6.930 N Vps35 n/a
7 TRCN0000379526 AGCTTAACCTTGAACATATTG pLKO_005 1185 CDS 100% 13.200 10.560 N Vps35 n/a
8 TRCN0000155350 CCAGACTATCAGTGCTTTGAT pLKO.1 1735 CDS 100% 5.625 3.938 N VPS35 n/a
9 TRCN0000111558 GCTGTCACCAAAGAGTTACTA pLKO.1 211 CDS 100% 5.625 3.938 N Vps35 n/a
10 TRCN0000318219 GCTGTCACCAAAGAGTTACTA pLKO_005 211 CDS 100% 5.625 3.938 N Vps35 n/a
11 TRCN0000111559 GCTGATGAACAGAGCCTTGTT pLKO.1 1493 CDS 100% 4.950 3.465 N Vps35 n/a
12 TRCN0000318221 GCTGATGAACAGAGCCTTGTT pLKO_005 1493 CDS 100% 4.950 3.465 N Vps35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022997.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03643 pDONR223 100% 91.4% 99.3% None (many diffs) n/a
2 ccsbBroad304_03643 pLX_304 0% 91.4% 99.3% V5 (many diffs) n/a
3 TRCN0000492290 TTATCTTGTACCTTCATGGTCTAT pLX_317 17% 91.4% 99.3% V5 (many diffs) n/a
Download CSV