Transcript: Mouse NM_023060.3

Mus musculus eukaryotic elongation factor, selenocysteine-tRNA-specific (Eefsec), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Eefsec (65967)
Length:
2679
CDS:
61..1812

Additional Resources:

NCBI RefSeq record:
NM_023060.3
NBCI Gene record:
Eefsec (65967)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023060.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000292899 CCAGACTAGATGCCGACATTC pLKO_005 1313 CDS 100% 10.800 15.120 N Eefsec n/a
2 TRCN0000173572 GAACTGACCAACGAAGGAAAT pLKO.1 2509 3UTR 100% 10.800 15.120 N Eefsec n/a
3 TRCN0000292896 GAACTGACCAACGAAGGAAAT pLKO_005 2509 3UTR 100% 10.800 15.120 N Eefsec n/a
4 TRCN0000193966 GATTTGATGATGCTCGTGATT pLKO.1 349 CDS 100% 4.950 3.465 N Eefsec n/a
5 TRCN0000292897 GATTTGATGATGCTCGTGATT pLKO_005 349 CDS 100% 4.950 3.465 N Eefsec n/a
6 TRCN0000194370 CACTGCCATTGCACTGTTATT pLKO.1 1907 3UTR 100% 13.200 7.920 N Eefsec n/a
7 TRCN0000292824 CACTGCCATTGCACTGTTATT pLKO_005 1907 3UTR 100% 13.200 7.920 N Eefsec n/a
8 TRCN0000173592 GACCTTGAAGAATGGAGGTTT pLKO.1 2269 3UTR 100% 4.950 2.970 N Eefsec n/a
9 TRCN0000292827 GACCTTGAAGAATGGAGGTTT pLKO_005 2269 3UTR 100% 4.950 2.970 N Eefsec n/a
10 TRCN0000154374 CAGATTTCCATCCCAACGAGA pLKO.1 652 CDS 100% 2.640 1.584 N EEFSEC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023060.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000477372 AACGCCATTCTTCTCATAGTACCG pLX_317 24.6% 79.1% 82% V5 (many diffs) n/a
Download CSV