Transcript: Human NM_023079.5

Homo sapiens ubiquitin conjugating enzyme E2 Z (UBE2Z), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
UBE2Z (65264)
Length:
3084
CDS:
98..1162

Additional Resources:

NCBI RefSeq record:
NM_023079.5
NBCI Gene record:
UBE2Z (65264)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_023079.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041214 CGGGATATCATGTCCATTTAT pLKO.1 413 CDS 100% 15.000 21.000 N Ube2z n/a
2 TRCN0000324885 CGGGATATCATGTCCATTTAT pLKO_005 413 CDS 100% 15.000 21.000 N Ube2z n/a
3 TRCN0000320607 ACTGATGACAACGGGCAATAA pLKO_005 595 CDS 100% 13.200 18.480 N UBE2Z n/a
4 TRCN0000320606 GCGGGATATCATGTCCATTTA pLKO_005 412 CDS 100% 13.200 18.480 N UBE2Z n/a
5 TRCN0000041217 CTCGGGTCAAACTGATGACAA pLKO.1 585 CDS 100% 4.950 6.930 N Ube2z n/a
6 TRCN0000022406 GCCAAACTATGCAGGACCCTT pLKO.1 978 CDS 100% 2.640 3.696 N UBE2Z n/a
7 TRCN0000022405 CAAACTGATGACAACGGGCAA pLKO.1 592 CDS 100% 2.160 3.024 N UBE2Z n/a
8 TRCN0000022407 CGGCACGAGACCATCAGAGTT pLKO.1 830 CDS 100% 1.650 1.320 N UBE2Z n/a
9 TRCN0000350260 CATTGATCACAGGCCCATTTG pLKO_005 495 CDS 100% 10.800 7.560 N UBE2Z n/a
10 TRCN0000320608 GTTTCTTCCTGTTCGTGTTTC pLKO_005 534 CDS 100% 10.800 7.560 N UBE2Z n/a
11 TRCN0000022404 CCTGGCTTTGTTGCTTCTCTA pLKO.1 2306 3UTR 100% 4.950 3.465 N UBE2Z n/a
12 TRCN0000320605 CCTGGCTTTGTTGCTTCTCTA pLKO_005 2306 3UTR 100% 4.950 3.465 N UBE2Z n/a
13 TRCN0000022408 TCTGCTTGAGTATTCTAGGTA pLKO.1 657 CDS 100% 3.000 2.100 N UBE2Z n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023079.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12517 pDONR223 100% 69.3% 69.4% None 1_324del;846C>T n/a
2 ccsbBroad304_12517 pLX_304 0% 69.3% 69.4% V5 1_324del;846C>T n/a
3 TRCN0000478813 TAATAATCCCCTCTGATATATGAC pLX_317 51.3% 69.3% 69.4% V5 1_324del;846C>T n/a
Download CSV