Transcript: Mouse NM_023122.3

Mus musculus glycoprotein m6b (Gpm6b), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gpm6b (14758)
Length:
2932
CDS:
191..1000

Additional Resources:

NCBI RefSeq record:
NM_023122.3
NBCI Gene record:
Gpm6b (14758)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023122.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434004 AGGATATGACCCTAGATTTAC pLKO_005 1358 3UTR 100% 13.200 18.480 N Gpm6b n/a
2 TRCN0000438072 AGTCGTGGCATGTCCAGTTAA pLKO_005 1262 3UTR 100% 13.200 18.480 N Gpm6b n/a
3 TRCN0000063816 CCGATGCATCAGTGGAATGTT pLKO.1 520 CDS 100% 5.625 4.500 N GPM6B n/a
4 TRCN0000091445 GTCTTCTAACTGGGCTTACTT pLKO.1 871 CDS 100% 5.625 4.500 N Gpm6b n/a
5 TRCN0000413215 CAACTCAATTCTTACACTTAA pLKO_005 980 CDS 100% 13.200 9.240 N Gpm6b n/a
6 TRCN0000091444 GCCAGTGTTTATGTTCTACAA pLKO.1 601 CDS 100% 4.950 3.465 N Gpm6b n/a
7 TRCN0000091446 GTGATCCAACTGATGCAGTAT pLKO.1 380 CDS 100% 4.950 3.465 N Gpm6b n/a
8 TRCN0000091447 CATCTGCAACACGAATGAGTT pLKO.1 766 CDS 100% 4.950 2.970 N Gpm6b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023122.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00668 pDONR223 100% 65.9% 67.9% None (many diffs) n/a
2 ccsbBroad304_00668 pLX_304 0% 65.9% 67.9% V5 (many diffs) n/a
3 TRCN0000470278 AGTCGACGGCATAAACCGTTCCGG pLX_317 37.1% 65.9% 67.9% V5 (many diffs) n/a
Download CSV