Transcript: Mouse NM_023179.3

Mus musculus ATPase, H+ transporting, lysosomal V1 subunit G2 (Atp6v1g2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Atp6v1g2 (66237)
Length:
1514
CDS:
169..525

Additional Resources:

NCBI RefSeq record:
NM_023179.3
NBCI Gene record:
Atp6v1g2 (66237)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101503 CAACTATCGGGTTACTGTCTA pLKO.1 504 CDS 100% 4.950 6.930 N Atp6v1g2 n/a
2 TRCN0000101501 CTCAAATGGAGGTGGAGCAAT pLKO.1 287 CDS 100% 4.950 3.465 N Atp6v1g2 n/a
3 TRCN0000101504 CTTCTCGGCATGGTCTGTGAA pLKO.1 463 CDS 100% 4.950 3.465 N Atp6v1g2 n/a
4 TRCN0000101500 GCTGTGAATTATCTGTGAGAA pLKO.1 1031 3UTR 100% 4.950 3.465 N Atp6v1g2 n/a
5 TRCN0000101502 GCAGGCCACAAGACGGCAGGT pLKO.1 390 CDS 100% 0.000 0.000 N Atp6v1g2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00139 pDONR223 100% 89.8% 94.9% None (many diffs) n/a
2 ccsbBroad304_00139 pLX_304 0% 89.8% 94.9% V5 (many diffs) n/a
3 TRCN0000470033 TTCTCGCCAATTACAGACCAGTTT pLX_317 100% 89.8% 94.9% V5 (many diffs) n/a
Download CSV