Transcript: Mouse NM_023320.2

Mus musculus pleckstrin homology domain containing, family O member 1 (Plekho1), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Plekho1 (67220)
Length:
1370
CDS:
43..1269

Additional Resources:

NCBI RefSeq record:
NM_023320.2
NBCI Gene record:
Plekho1 (67220)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023320.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339908 TCCGGAAATTCTGCGGGAAAG pLKO_005 122 CDS 100% 6.000 8.400 N Plekho1 n/a
2 TRCN0000189874 CCTCAGATGGGATGCTAACAT pLKO.1 578 CDS 100% 5.625 4.500 N Plekho1 n/a
3 TRCN0000339905 CCTCAGATGGGATGCTAACAT pLKO_005 578 CDS 100% 5.625 4.500 N Plekho1 n/a
4 TRCN0000202420 GAAATTCTGCGGGAAAGGGAT pLKO.1 126 CDS 100% 2.640 2.112 N Plekho1 n/a
5 TRCN0000192546 GCTAACATTAGACCTGATCCA pLKO.1 591 CDS 100% 2.640 2.112 N Plekho1 n/a
6 TRCN0000339977 ACGCCCTGAGTTCTGCCATTA pLKO_005 413 CDS 100% 10.800 7.560 N Plekho1 n/a
7 TRCN0000339975 AGTGCGAAGAGCTCCGGAAAT pLKO_005 269 CDS 100% 10.800 7.560 N Plekho1 n/a
8 TRCN0000189593 CTACCTCAGATGGGATGCTAA pLKO.1 575 CDS 100% 4.950 3.465 N Plekho1 n/a
9 TRCN0000190142 GTCCTGAAGAGAAGGAGTCAT pLKO.1 386 CDS 100% 4.950 3.465 N Plekho1 n/a
10 TRCN0000189875 CTTCAAGCTGAGGAATCCCTA pLKO.1 904 CDS 100% 2.640 1.848 N Plekho1 n/a
11 TRCN0000202056 CTTCACCTTCAAGCTGAGGAA pLKO.1 898 CDS 100% 2.640 1.848 N Plekho1 n/a
12 TRCN0000339906 CGTCTCCGAGAAGGAGGTAAA pLKO_005 201 CDS 100% 10.800 6.480 N Plekho1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023320.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03238 pDONR223 100% 88% 90.2% None (many diffs) n/a
2 ccsbBroad304_03238 pLX_304 0% 88% 90.2% V5 (many diffs) n/a
3 TRCN0000466090 CTCTGTACCGTATTTAGTGGACCC pLX_317 16.1% 88% 90.2% V5 (many diffs) n/a
Download CSV