Transcript: Mouse NM_023420.2

Mus musculus collagen, type IV, alpha 3 (Goodpasture antigen) binding protein (Col4a3bp), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Col4a3bp (68018)
Length:
5363
CDS:
430..2304

Additional Resources:

NCBI RefSeq record:
NM_023420.2
NBCI Gene record:
Col4a3bp (68018)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079176 GCACAATACCAATGGTAATAA pLKO.1 1080 CDS 100% 15.000 21.000 N Col4a3bp n/a
2 TRCN0000363397 GATAATGCAATCATCGTTTAT pLKO_005 1885 CDS 100% 13.200 18.480 N Col4a3bp n/a
3 TRCN0000362460 TCACATGGATATGGCTATATT pLKO_005 2515 3UTR 100% 15.000 12.000 N Col4a3bp n/a
4 TRCN0000079175 CCGGTTTGATATCAGTGTAAA pLKO.1 681 CDS 100% 13.200 10.560 N Col4a3bp n/a
5 TRCN0000079177 CACAAGACTGAATCGGGATAT pLKO.1 772 CDS 100% 10.800 8.640 N Col4a3bp n/a
6 TRCN0000079174 GCGTACAAGAATGTGATGGAA pLKO.1 1297 CDS 100% 3.000 2.400 N Col4a3bp n/a
7 TRCN0000379394 ATGAGCTTCAGAGGGATAAAG pLKO_005 1004 CDS 100% 13.200 9.240 N Col4a3bp n/a
8 TRCN0000079173 CCCAAGAAGAAACATTGCAAT pLKO.1 2416 3UTR 100% 4.950 2.970 N Col4a3bp n/a
9 TRCN0000380482 AGCTGGAACGTAGGATCTATA pLKO_005 2382 3UTR 100% 13.200 9.240 N CERT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02307 pDONR223 100% 86.4% 92.4% None (many diffs) n/a
2 ccsbBroad304_02307 pLX_304 0% 86.4% 92.4% V5 (many diffs) n/a
3 ccsbBroadEn_14952 pDONR223 0% 86.4% 92.4% None (many diffs) n/a
4 ccsbBroad304_14952 pLX_304 0% 86.4% 92.4% V5 (many diffs) n/a
5 TRCN0000469218 AAAGCCCTTGACCATACCTTCCCA pLX_317 19.8% 86.4% 92.4% V5 (many diffs) n/a
6 TRCN0000487843 CTGCCGGGATGTCGATATGCACCT pLX_317 17% 86.4% 92.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV