Transcript: Mouse NM_023538.2

Mus musculus acylglycerol kinase (Agk), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Agk (69923)
Length:
2225
CDS:
60..1325

Additional Resources:

NCBI RefSeq record:
NM_023538.2
NBCI Gene record:
Agk (69923)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361847 ACTGTTGTCAAGACGGATTAT pLKO_005 345 CDS 100% 13.200 18.480 N Agk n/a
2 TRCN0000361786 GGCAAAGCCAGAACTCTATTT pLKO_005 279 CDS 100% 13.200 18.480 N Agk n/a
3 TRCN0000024799 CGTCTCTGTATAGGAGAATAT pLKO.1 874 CDS 100% 13.200 10.560 N Agk n/a
4 TRCN0000368281 TTGTGGTCAGTACCCTGTTAA pLKO_005 1499 3UTR 100% 13.200 10.560 N Agk n/a
5 TRCN0000236011 TGGAAACAAAGTCCAACATAT pLKO_005 563 CDS 100% 13.200 9.240 N AGK n/a
6 TRCN0000361857 TGGAAACAAAGTCCAACATAT pLKO_005 563 CDS 100% 13.200 9.240 N Agk n/a
7 TRCN0000368277 GTGAGGTTGTTCCCTCTTTAG pLKO_005 1818 3UTR 100% 10.800 7.560 N Agk n/a
8 TRCN0000358552 TCAGAGATGCTGGCGTCAAAG pLKO_005 700 CDS 100% 10.800 7.560 N AGK n/a
9 TRCN0000024801 CCCAATGCACAAGTGAAGAAA pLKO.1 225 CDS 100% 5.625 3.938 N Agk n/a
10 TRCN0000024800 CTTTGCTGAAAGTGGAAACAA pLKO.1 551 CDS 100% 5.625 3.938 N Agk n/a
11 TRCN0000152111 CAGTAAGATTCCCATTGGATT pLKO.1 491 CDS 100% 4.950 3.465 N AGK n/a
12 TRCN0000153540 CCATTGAACTGTCCATCACAA pLKO.1 985 CDS 100% 4.950 3.465 N AGK n/a
13 TRCN0000024803 CAGGAGGTTGTTACTGGAGTA pLKO.1 444 CDS 100% 4.050 2.835 N Agk n/a
14 TRCN0000156414 CCACCATTGAACTGTCCATCA pLKO.1 982 CDS 100% 4.050 2.835 N AGK n/a
15 TRCN0000236012 TAAGATTCCCATTGGATTTAT pLKO_005 494 CDS 100% 15.000 9.000 N AGK n/a
16 TRCN0000024802 CCTGATGAGCAAAGAGGATTT pLKO.1 1025 CDS 100% 10.800 6.480 N Agk n/a
17 TRCN0000157186 GAAGCTCAGGTGTTTGGCAAT pLKO.1 192 CDS 100% 4.050 2.835 N AGK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08577 pDONR223 100% 87.5% 91.7% None (many diffs) n/a
2 ccsbBroad304_08577 pLX_304 0% 87.5% 91.7% V5 (many diffs) n/a
3 TRCN0000471201 TCAACACGTGCAGTGTTACCCGGG pLX_317 33% 87.5% 91.7% V5 (many diffs) n/a
4 ccsbBroadEn_15107 pDONR223 0% 87.5% 91.7% None (many diffs) n/a
5 TRCN0000472791 ATAGCGTTCTCAGCCTTGGACTTT pLX_317 32.8% 87.5% 91.7% V5 (many diffs) n/a
Download CSV