Transcript: Mouse NM_023580.4

Mus musculus Eph receptor A1 (Epha1), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Epha1 (13835)
Length:
3273
CDS:
59..2992

Additional Resources:

NCBI RefSeq record:
NM_023580.4
NBCI Gene record:
Epha1 (13835)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023580.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023447 CCTTACGCCAACTACACATTT pLKO.1 1292 CDS 100% 13.200 18.480 N Epha1 n/a
2 TRCN0000023444 CCACACATTCTACGCCTAGAA pLKO.1 2108 CDS 100% 0.495 0.693 N Epha1 n/a
3 TRCN0000023445 GCTCTGCTGATCGGGATTTAT pLKO.1 1739 CDS 100% 15.000 10.500 N Epha1 n/a
4 TRCN0000361121 ACTACACATTTACCGTCAAAT pLKO_005 1302 CDS 100% 13.200 9.240 N Epha1 n/a
5 TRCN0000378463 AGCTCTGCTGATCGGGATTTA pLKO_005 1738 CDS 100% 13.200 9.240 N Epha1 n/a
6 TRCN0000378482 GTGGAGTGAGGTGCAACAAAT pLKO_005 211 CDS 100% 13.200 9.240 N Epha1 n/a
7 TRCN0000023446 CTATGAAGAAAGCAGTGGAAA pLKO.1 862 CDS 100% 4.950 3.465 N Epha1 n/a
8 TRCN0000023448 GATGACTTTGACGGCACCTAT pLKO.1 2384 CDS 100% 4.950 3.465 N Epha1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023580.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06167 pDONR223 100% 85.8% 88.3% None (many diffs) n/a
2 ccsbBroad304_06167 pLX_304 0% 85.8% 88.3% V5 (many diffs) n/a
3 TRCN0000476673 TGAAGGTTCAAGTTTATTGGGATC pLX_317 13.5% 85.8% 88.3% V5 (many diffs) n/a
4 TRCN0000470123 TCAGTCTCGTAAGAGAGCTGTTAG pLX_317 15.7% 85.8% 88.3% V5 (many diffs) n/a
5 ccsbBroadEn_14625 pDONR223 0% 85.7% 88.2% None (many diffs) n/a
6 ccsbBroad304_14625 pLX_304 0% 85.7% 88.2% V5 (many diffs) n/a
Download CSV