Transcript: Mouse NM_023653.5

Mus musculus wingless-type MMTV integration site family, member 2 (Wnt2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Wnt2 (22413)
Length:
2115
CDS:
159..1241

Additional Resources:

NCBI RefSeq record:
NM_023653.5
NBCI Gene record:
Wnt2 (22413)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023653.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054963 CCTTAGAAAGTGATTGCTATT pLKO.1 1921 3UTR 100% 10.800 15.120 N Wnt2 n/a
2 TRCN0000054965 CTGTAGCCAATAAGAGGTTTA pLKO.1 919 CDS 100% 10.800 15.120 N Wnt2 n/a
3 TRCN0000054966 GCGTTGTATTTGCCATCACCA pLKO.1 511 CDS 100% 2.640 3.696 N Wnt2 n/a
4 TRCN0000054967 GCGAAGTTATGTGTTGTGGGA pLKO.1 1069 CDS 100% 0.660 0.924 N Wnt2 n/a
5 TRCN0000042623 CCCATCAGTTTAAGGATTCTT pLKO.1 1951 3UTR 100% 5.625 3.938 N Wnt2 n/a
6 TRCN0000042626 CAGCTCTTCATGGTGGTACAT pLKO.1 227 CDS 100% 4.950 3.465 N Wnt2 n/a
7 TRCN0000042624 CGACTATCTCTGGAGGAAGTA pLKO.1 851 CDS 100% 4.950 3.465 N Wnt2 n/a
8 TRCN0000054964 GACAGAGATCACAGCCTCTTT pLKO.1 429 CDS 100% 4.950 3.465 N Wnt2 n/a
9 TRCN0000042627 GATGACCAAGTGTGAGTGTAA pLKO.1 1118 CDS 100% 4.950 3.465 N Wnt2 n/a
10 TRCN0000033371 CCAGATGTGATGCGTGCCATT pLKO.1 333 CDS 100% 4.050 2.835 N WNT2 n/a
11 TRCN0000042625 CCTGTAGCCAAGGAGAATTAA pLKO.1 535 CDS 100% 15.000 9.000 N Wnt2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023653.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01778 pDONR223 100% 91.7% 96.3% None (many diffs) n/a
2 ccsbBroad304_01778 pLX_304 0% 91.7% 96.3% V5 (many diffs) n/a
3 TRCN0000468916 GATTATTAGTCAGGACCTGATCGC pLX_317 33.2% 91.7% 96.3% V5 (many diffs) n/a
Download CSV