Transcript: Human NM_024072.4

Homo sapiens DEAD-box helicase 54 (DDX54), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
DDX54 (79039)
Length:
4377
CDS:
28..2673

Additional Resources:

NCBI RefSeq record:
NM_024072.4
NBCI Gene record:
DDX54 (79039)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024072.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049957 CCCGGTGTTCAAAGGCATCAT pLKO.1 342 CDS 100% 4.950 3.465 N DDX54 n/a
2 TRCN0000289044 CCCGGTGTTCAAAGGCATCAT pLKO_005 342 CDS 100% 4.950 3.465 N DDX54 n/a
3 TRCN0000049954 GCAGACCCTGAAGTTCACTAA pLKO.1 567 CDS 100% 4.950 3.465 N DDX54 n/a
4 TRCN0000288992 GCAGACCCTGAAGTTCACTAA pLKO_005 567 CDS 100% 4.950 3.465 N DDX54 n/a
5 TRCN0000049955 GCTGGACAATGTCATCAACTA pLKO.1 1245 CDS 100% 4.950 3.465 N DDX54 n/a
6 TRCN0000049953 CGCAAGATCAATCTCGCCAAA pLKO.1 1156 CDS 100% 4.050 2.835 N DDX54 n/a
7 TRCN0000288991 CGCAAGATCAATCTCGCCAAA pLKO_005 1156 CDS 100% 4.050 2.835 N DDX54 n/a
8 TRCN0000049956 CCGCTACATCAGCAGCTCCTA pLKO.1 2295 CDS 100% 0.880 0.616 N DDX54 n/a
9 TRCN0000288994 CCGCTACATCAGCAGCTCCTA pLKO_005 2295 CDS 100% 0.880 0.616 N DDX54 n/a
10 TRCN0000197737 GAACAAGAAGAAGAAGAAGAA pLKO.1 291 CDS 100% 4.950 2.475 Y Rps19bp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024072.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12534 pDONR223 100% 23.4% 21.3% None (many diffs) n/a
2 ccsbBroad304_12534 pLX_304 0% 23.4% 21.3% V5 (many diffs) n/a
3 TRCN0000473988 CTATGCCCTACGCCATCGACTTTT pLX_317 69% 23.4% 21.3% V5 (many diffs) n/a
Download CSV