Transcript: Mouse NM_024166.6

Mus musculus coiled-coil-helix-coiled-coil-helix domain containing 2 (Chchd2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Chchd2 (14004)
Length:
910
CDS:
224..685

Additional Resources:

NCBI RefSeq record:
NM_024166.6
NBCI Gene record:
Chchd2 (14004)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024166.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183263 GATGTAACATTGGTTCTGTAT pLKO.1 707 3UTR 100% 4.950 2.970 N Chchd2 n/a
2 TRCN0000251043 ACAAGTGTGGACCCTTATATT pLKO_005 738 3UTR 100% 15.000 7.500 Y Chchd2 n/a
3 TRCN0000215977 CAGGATTGCAAATGGTTTAAT pLKO.1 661 CDS 100% 15.000 7.500 Y Chchd2 n/a
4 TRCN0000251042 CAGGATTGCAAATGGTTTAAT pLKO_005 661 CDS 100% 15.000 7.500 Y Chchd2 n/a
5 TRCN0000180376 GTACAAGTGTGGACCCTTATA pLKO.1 736 3UTR 100% 13.200 6.600 Y Chchd2 n/a
6 TRCN0000251040 CTCTAGAGATCAAGCAGTTTC pLKO_005 573 CDS 100% 10.800 5.400 Y Chchd2 n/a
7 TRCN0000251041 GCAAAGCCCGACATCACTTAC pLKO_005 500 CDS 100% 10.800 5.400 Y Chchd2 n/a
8 TRCN0000184420 GACCTTGCTCTCTAGAGATCA pLKO.1 564 CDS 100% 4.950 2.475 Y Chchd2 n/a
9 TRCN0000265318 TCAGAACCAGAGCGATGTCAA pLKO_005 604 CDS 100% 4.950 2.475 Y Chchd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024166.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03226 pDONR223 100% 82% 84.9% None (many diffs) n/a
2 ccsbBroad304_03226 pLX_304 0% 82% 84.9% V5 (many diffs) n/a
3 TRCN0000465810 ATACCTTGAAAATTCGGAATATGT pLX_317 85.6% 82% 84.9% V5 (many diffs) n/a
Download CSV