Transcript: Mouse NM_024237.4

Mus musculus fibulin 7 (Fbln7), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Fbln7 (70370)
Length:
2922
CDS:
142..1464

Additional Resources:

NCBI RefSeq record:
NM_024237.4
NBCI Gene record:
Fbln7 (70370)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024237.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437915 AGCGTGGTGTGTCTTGCTAAT pLKO_005 493 CDS 100% 10.800 15.120 N Fbln7 n/a
2 TRCN0000109551 CGGCAATATAAGCTACGTGAA pLKO.1 1059 CDS 100% 4.050 3.240 N Fbln7 n/a
3 TRCN0000442728 GCTACCTACCAGGGTACTTTA pLKO_005 1941 3UTR 100% 13.200 9.240 N Fbln7 n/a
4 TRCN0000416441 AGTTTGGAAGCAAGTACTTAG pLKO_005 416 CDS 100% 10.800 7.560 N Fbln7 n/a
5 TRCN0000053946 CCAAGACCATCTCCTTCCATT pLKO.1 1145 CDS 100% 4.950 3.465 N FBLN7 n/a
6 TRCN0000109550 GTTTGAGATCTGGGCTGATTT pLKO.1 1492 3UTR 100% 13.200 7.920 N Fbln7 n/a
7 TRCN0000109554 CAAGACCATCTCCTTCCATTA pLKO.1 1146 CDS 100% 10.800 6.480 N Fbln7 n/a
8 TRCN0000109552 CCATGTATCCAAGGTCACCAT pLKO.1 1419 CDS 100% 2.640 1.584 N Fbln7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024237.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04855 pDONR223 100% 77.1% 76.3% None (many diffs) n/a
2 ccsbBroad304_04855 pLX_304 0% 77.1% 76.3% V5 (many diffs) n/a
3 TRCN0000476735 TTCGGATTATGATGCACGAGTGCT pLX_317 35.9% 77.1% 76.3% V5 (many diffs) n/a
Download CSV