Transcript: Human NM_024294.4

Homo sapiens inflammation and lipid regulator with UBA-like and NBR1-like domains (ILRUN), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ILRUN (64771)
Length:
4338
CDS:
165..1061

Additional Resources:

NCBI RefSeq record:
NM_024294.4
NBCI Gene record:
ILRUN (64771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024294.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430606 GCAGCAATTGGCGCCTATTAT pLKO_005 333 CDS 100% 15.000 21.000 N ILRUN n/a
2 TRCN0000419891 TCCGGATACTCAGTTTGTAAA pLKO_005 434 CDS 100% 13.200 18.480 N ILRUN n/a
3 TRCN0000140195 GAGTTCGACTCGATCAGCAAA pLKO.1 864 CDS 100% 4.950 6.930 N ILRUN n/a
4 TRCN0000425743 TTAAACGGGTGTCAGCAAGAA pLKO_005 1058 CDS 100% 4.950 6.930 N ILRUN n/a
5 TRCN0000144085 CTTTGTTGAAGATGTCACCAT pLKO.1 392 CDS 100% 2.640 3.696 N ILRUN n/a
6 TRCN0000429469 CATCAGTCTAACAAGTCATTA pLKO_005 1321 3UTR 100% 13.200 9.240 N ILRUN n/a
7 TRCN0000414962 AGAACCGACAATCAGATGAAA pLKO_005 817 CDS 100% 5.625 3.938 N ILRUN n/a
8 TRCN0000426426 AGACCAATTTGGACATGTGAA pLKO_005 524 CDS 100% 4.950 3.465 N ILRUN n/a
9 TRCN0000145604 CACGCAAACAACTTATCAGTA pLKO.1 990 CDS 100% 4.950 3.465 N ILRUN n/a
10 TRCN0000425236 GAGTAACGCAGCAGCTGTCAT pLKO_005 721 CDS 100% 4.950 3.465 N ILRUN n/a
11 TRCN0000121618 GCCAATGAGTTATCACCCTTT pLKO.1 1651 3UTR 100% 4.050 2.835 N ILRUN n/a
12 TRCN0000139654 CCCAAGAGATTGCAGATGTCA pLKO.1 571 CDS 100% 3.000 2.100 N ILRUN n/a
13 TRCN0000143122 CAAGACCAGAATAGACTGTCA pLKO.1 939 CDS 100% 2.640 1.848 N ILRUN n/a
14 TRCN0000139198 CAGGAATGTATCAGGGACAGT pLKO.1 619 CDS 100% 2.640 1.848 N ILRUN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024294.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03964 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03964 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467794 CTGACCCCTTCAGTACCCGCCGCT pLX_317 43.5% 100% 100% V5 n/a
Download CSV