Transcript: Human NM_024334.2

Homo sapiens transmembrane protein 43 (TMEM43), mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
TMEM43 (79188)
Length:
3343
CDS:
255..1457

Additional Resources:

NCBI RefSeq record:
NM_024334.2
NBCI Gene record:
TMEM43 (79188)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142081 CCTCAACCTTATGACACGGAT pLKO.1 1220 CDS 100% 2.640 3.696 N TMEM43 n/a
2 TRCN0000145441 GAGGTGTTTCATAGAGAACTA pLKO.1 1137 CDS 100% 4.950 3.960 N TMEM43 n/a
3 TRCN0000140969 CCTTATGACACGGATCCTCTA pLKO.1 1226 CDS 100% 4.050 3.240 N TMEM43 n/a
4 TRCN0000143247 GAGATGTACCAATGGGTAGAA pLKO.1 612 CDS 100% 4.950 3.465 N TMEM43 n/a
5 TRCN0000142605 GTGAAGAAGGAGACGAGGTAT pLKO.1 669 CDS 100% 4.950 3.465 N TMEM43 n/a
6 TRCN0000141539 CCTTTGTCCAAATTGGCAGGT pLKO.1 802 CDS 100% 2.160 1.512 N TMEM43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04070 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04070 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474125 GACTGACCGACTGGTCCCCTAGCC pLX_317 29% 100% 100% V5 n/a
4 ccsbBroadEn_15983 pDONR223 0% 99.7% 99.2% None 504A>T;536T>C;1013C>T n/a
5 ccsbBroad304_15983 pLX_304 0% 99.7% 99.2% V5 504A>T;536T>C;1013C>T n/a
6 TRCN0000470137 CTTAAATGCTCTCTACTCTTACAG pLX_317 29.9% 99.7% 99.2% V5 504A>T;536T>C;1013C>T n/a
7 ccsbBroadEn_12558 pDONR223 100% 57% 57% None 1_516del n/a
8 ccsbBroad304_12558 pLX_304 0% 57% 57% V5 1_516del n/a
9 TRCN0000474687 ACGTTTCTACGGTGTCCTGTTTAG pLX_317 80.9% 57% 57% V5 1_516del n/a
Download CSV