Transcript: Human NM_024533.5

Homo sapiens carbohydrate sulfotransferase 5 (CHST5), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
CHST5 (23563)
Length:
3554
CDS:
1700..2935

Additional Resources:

NCBI RefSeq record:
NM_024533.5
NBCI Gene record:
CHST5 (23563)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024533.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034901 CGACCTGATGCGCTCTATCTT pLKO.1 2044 CDS 100% 5.625 7.875 N CHST5 n/a
2 TRCN0000034899 CCTTCCATACTTCGTCTAGGA pLKO.1 2718 CDS 100% 2.640 3.696 N CHST5 n/a
3 TRCN0000034903 AGCCGAAACCTGTCCGCCTTT pLKO.1 2105 CDS 100% 1.350 1.890 N CHST5 n/a
4 TRCN0000034900 CCATCAGCAAGCAGGACGTAT pLKO.1 2190 CDS 100% 4.950 3.465 N CHST5 n/a
5 TRCN0000034902 GTTGCCCTTCACTAAGATCCT pLKO.1 2773 CDS 100% 2.640 1.848 N CHST5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024533.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02796 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02796 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478129 AGTCCTGCGACTCTTTAGTAAACC pLX_317 14.4% 100% 100% V5 n/a
4 ccsbBroadEn_00984 pDONR223 100% 82.1% 79.8% None (many diffs) n/a
5 ccsbBroad304_00984 pLX_304 0% 82.1% 79.8% V5 (many diffs) n/a
6 TRCN0000476758 CTTATATGGGCAACACTCGCCGTC pLX_317 32.1% 82.1% 79.8% V5 (many diffs) n/a
Download CSV