Transcript: Human NM_024626.4

Homo sapiens V-set domain containing T cell activation inhibitor 1 (VTCN1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
VTCN1 (79679)
Length:
2605
CDS:
73..921

Additional Resources:

NCBI RefSeq record:
NM_024626.4
NBCI Gene record:
VTCN1 (79679)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024626.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428143 GAAGTGAATGTGGACTATAAT pLKO_005 532 CDS 100% 15.000 10.500 N VTCN1 n/a
2 TRCN0000426708 GGAATGCTAACCTTGAGTATA pLKO_005 488 CDS 100% 13.200 9.240 N VTCN1 n/a
3 TRCN0000147548 GCTCTACAATGTTACGATCAA pLKO.1 711 CDS 100% 4.950 3.465 N VTCN1 n/a
4 TRCN0000150224 GCTTCTAAGTTTCTTTCCCTT pLKO.1 2213 3UTR 100% 2.640 1.848 N VTCN1 n/a
5 TRCN0000146791 CCTGACATCAAACTTTCTGAT pLKO.1 250 CDS 100% 4.950 2.970 N VTCN1 n/a
6 TRCN0000147466 CATGAGTTCAAAGAAGGCAAA pLKO.1 313 CDS 100% 4.050 2.430 N VTCN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024626.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12592 pDONR223 100% 66.3% 66.3% None 1_285del n/a
2 ccsbBroad304_12592 pLX_304 0% 66.3% 66.3% V5 1_285del n/a
3 TRCN0000465576 TTCAATATGGCCTGAGTCCGTGCG pLX_317 62.1% 66.3% 66.3% V5 1_285del n/a
Download CSV