Transcript: Human NM_024894.4

Homo sapiens nucleolar protein 10 (NOL10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
NOL10 (79954)
Length:
3498
CDS:
115..2181

Additional Resources:

NCBI RefSeq record:
NM_024894.4
NBCI Gene record:
NOL10 (79954)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024894.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151973 CGATGTTATGACACCTATCAA pLKO.1 346 CDS 100% 5.625 7.875 N NOL10 n/a
2 TRCN0000157872 CGGGCATATATGCATGGGTTT pLKO.1 1300 CDS 100% 4.050 5.670 N NOL10 n/a
3 TRCN0000151787 CCAGAAACCAAGGTTTATCAT pLKO.1 2513 3UTR 100% 5.625 3.938 N NOL10 n/a
4 TRCN0000153723 CCAGAGCATGACCTTAATGAT pLKO.1 1045 CDS 100% 5.625 3.938 N NOL10 n/a
5 TRCN0000152081 CCAACCTGTAATAATGGGAAA pLKO.1 3331 3UTR 100% 4.050 2.835 N NOL10 n/a
6 TRCN0000152253 CCTTGAAGTTTGAAAGGTGTT pLKO.1 371 CDS 100% 4.050 2.835 N NOL10 n/a
7 TRCN0000152630 GCACACTTTCAAACACCAGAT pLKO.1 3003 3UTR 100% 4.050 2.835 N NOL10 n/a
8 TRCN0000153938 CCCAACCTGTAATAATGGGAA pLKO.1 3330 3UTR 100% 2.640 1.848 N NOL10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024894.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04150 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04150 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474127 CCTCGCTTTTACACCCGGAGTCTA pLX_317 20.9% 100% 100% V5 n/a
Download CSV