Transcript: Human NM_025211.4

Homo sapiens G kinase anchoring protein 1 (GKAP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
GKAP1 (80318)
Length:
1801
CDS:
429..1529

Additional Resources:

NCBI RefSeq record:
NM_025211.4
NBCI Gene record:
GKAP1 (80318)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025211.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412730 TTCAACTCAGTCCAAAGTTAT pLKO_005 890 CDS 100% 13.200 18.480 N GKAP1 n/a
2 TRCN0000037743 CGCTCAACATGATCTTCCATT pLKO.1 701 CDS 100% 4.950 3.960 N GKAP1 n/a
3 TRCN0000037742 GTCTCAAACTTTAGGAAGCAA pLKO.1 551 CDS 100% 3.000 2.400 N GKAP1 n/a
4 TRCN0000427084 CAAGCAGAGTTAGCCAAATAC pLKO_005 1458 CDS 100% 13.200 9.240 N GKAP1 n/a
5 TRCN0000037740 GACTGGAAGATGATGTTCATA pLKO.1 1063 CDS 100% 5.625 3.938 N GKAP1 n/a
6 TRCN0000037741 GAGGCAAAGTATAAGGAAGTA pLKO.1 1266 CDS 100% 4.950 3.465 N GKAP1 n/a
7 TRCN0000037739 GCTGTTTGTAACGCTCAACAT pLKO.1 690 CDS 100% 4.950 3.465 N GKAP1 n/a
8 TRCN0000412336 AGGCAAGAAATGCACAATTAT pLKO_005 1288 CDS 100% 15.000 7.500 Y GKAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025211.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04206 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04206 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470932 AAGGGCGCTTGCCAACTGACCGTC pLX_317 43.7% 100% 100% V5 n/a
4 TRCN0000487872 GGGACCAACACCTTACTTGGGCGC pLX_317 28.9% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV